1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
3 years ago
5

If a person eats salty food, his or her kidneys respond by excreting excess salt into the ____. sodium water urine blood Save

Biology
1 answer:
mr Goodwill [35]3 years ago
3 0
<span>If a person eats salty food, his or her kidneys respond by excreting excess salt into the urine.</span>
You might be interested in
Pea plants are tall if they have the genotype TT or Tt, and they are short if they have the genotype tt. A tall plant is mated w
Paladinen [302]

Answer:

heterozygous

Explanation:

6 0
3 years ago
Which of the following best describes an innate behavior that an organism is born with to help enhance its survival? (voice note
Alex_Xolod [135]

Answer:

A monarch butterfly migrating

Explanation:

I think it is the butterfly because butterfly's fly right after they come out of the cocoon  

4 0
2 years ago
How is a line graph different from a bar graph?
mario62 [17]
Line graphs can also be used to compare changes over the same period of time for more than one group. Bar graphs are used to compare things between different groups or to track changes over time.
3 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Which of the following domains include organisms that have a nucleus and
Olegator [25]

Answer:

The correct option is <em><u>B. Eukarya only</u></em>

Explanation:

Bacteria can be described as prokaryotic organisms that do not possess a nucleus. Their genetic material is generally present in the cytoplasm of the cell in a region called nucleoid. Some extra genetic material is found in them in the form of plasmids. Hence, option D is not correct.

The domain, Archae, contains prokaryotes and they lack a nucleus. Hence, option A and C are not correct.

Eukaryotes are multicellular organisms which contain a nucleus and other membrane-bound organelles. Hence, option B is correct.

5 0
3 years ago
Other questions:
  • What are the viruses two main structures
    12·1 answer
  • Some chemical signals are received by specific target cells. what is required for reception by a target cell?
    6·1 answer
  • A period of mass extinction is often followed by ________.
    8·1 answer
  • The female Anopheles Mosquito is vector for the malarial pathogen.
    6·1 answer
  • With global warming and climate change affecting the world’s environment, how long will it be before humans have nowhere left to
    12·2 answers
  • Arrange these components of the mammalian immune system as it first responds to a pathogen in the correct sequence. I. Pathogen
    12·1 answer
  • How do interactions among organisms affect their ecosystem
    13·1 answer
  • What is waters role In forming fossil
    13·2 answers
  • Completar:<br><br>En la de un cuerpo sólido no influye su .​
    9·1 answer
  • The plants in this ecosystem are dark in color to absorb sunlight, covered in hair and grow in clumps. What type of ecosystem co
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!