All categories

2 years ago

Which of the following chemical reactions is an oxidation-reduction reaction?

Chemistry

2 answers:

olchik [2.2K]2 years ago

8 0

Answer: 1. Option A and 2. Option D

In Redox reaction (oxidation-reduction) there should be change in oxidation no.

In A, oxidation no of W is changed from -6 to zero , Reduction (oxidation no Decreased) and oxidation no of Hydrogen is increased from zero to +1, oxidation (increase in oxidation no).

In remaining, there is no change in oxidation number.

2. Greater the concentration, more the collisions between the molecules and more the kinetic energy which reduce the activation energy and speed up the reaction.

8_murik_8 [283]2 years ago

7 0

1) Reactions which involves both a reduction process and a complementary oxidation process are called oxidation-reduction.they can't be double replacement reactions.
Hence,
WO3 + 3H2 ---> W + 3H2O is an oxidation-reduction reaction

You might be interested in

Calculate the decrease in temperarure when 2.00 L at 20.0 degrees celsius is compressed to 1.00 L.

Serga [27]

I suspect that the pressure of this change is constant therefore

The equation is used from the combined gas law. (When pressure is constant both P's will cancel out P/P = 1)
V/T = V/T
Initial Change

Initially we have 2L at 20 degress what temperature will be at 1L.

2/20 = 1/T
0.1 = 1/T
0.1T = 1
T = 1/0.1
T = 10 degress celsius.

Hope this helps if you won't be able to understand what is the combined gas law just tell me :).

3 0

3 years ago

In a mixture of hydrogen and nitrogen gases, the mole fraction of nitrogen is 0.333. If the partial pressure of hydrogen in the

notka56 [123]

Answer:

$P_T=112.4torr$

Explanation:

Hello there!

In this case, since these problems about gas mixtures are based off Dalton's law in terms of mole fraction, partial pressure and total pressure, we can write the following for hydrogen, we are given its partial pressure:

$P_{H_2}=x_{H_2}*P_T$

And can be solved for the total pressure as follows:

$P_T=\frac{P_{H_2}}{x_{H_2}}$

However, we first calculate the mole fraction of hydrogen by subtracting that of nitrogen to 1 due to:

$x_{H_2}+x_{N_2}=1\\\\x_{H_2}=1-0.333=0.667$

Then, we can plug in to obtain the total pressure:

$P_T=\frac{75.0torr}{0.667}\\\\P_T=112.4torr$

Regards!

4 0

2 years ago

DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte

uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0

3 years ago

Which statements describe how heat flows in foil? Check all that apply. Heat flows in all directions. Heat flows from left to ri

docker41 [41]

Answer:

A D F

Explanation:

Its right but its not in order But its A D and F

3 0

2 years ago

Is the sky a solid,liquid,or gas

DochEvi [55]

The air in the sky and the clouds are gas, however some things in the sky [such as the sun/moon] are solid.
Hope that helped!

5 0

2 years ago