1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neko [114]
3 years ago
10

Is a black widow endothermic or ectothermic? I'm doing a project I need help!

Biology
1 answer:
Stells [14]3 years ago
8 0
Endothermic means it requires the absorption  of heat or it is dependent on has the ablity to generate internal heat

exothermic means an animal that cna regulate its body temperature (usually by exchanging it with its surrounding environments)

so your answer is excothermic
You might be interested in
2. Which macromolecules were present in your saliva and food choices? Explain why you think you got the results you did.
JulijaS [17]
Starch is present in saliva. 

I don't know which food choice you made so I can't explain why you got the results you did.
4 0
3 years ago
Read 2 more answers
You observe a plant on your windowsill that is growing at an angle toward the outside. This is an example of a living thing ____
katrin2010 [14]

Answer:

response to stimuli / tropism

Explanation:

The plants and animals always respond to stimuli. It is an innate character of all living things. When a bright light falls on the eye, it closes immediately. This is responding to the stimuli. When someone touches the leaves of touch-me-not plants it closes its leaves due to the external stimuli.

The plants respond to the light. Because it does photosynthesis in the presence of light. Therefore, the leaves and branches of the plants always bend towards the light. This process is called phototropism.

Similarly, the roots of the plants move towards gravity under the ground. This is called geotropism.

Besides phototropism and geotropism, other types of stimuli are there - hydrotropism(response to the water), chemotropism(response to certain chemicals).

That's why the plants growing on the windowsill move towards outside where light comes.

7 0
3 years ago
What is the correct order of phases in the menstrual cycle? (1) progestational phase, (2) ovulation, (3) estrogenic phase, (4) m
ella [17]
The correct order of phases in the menstrual cycle is; 
 menses, .estrogenic phase, ovulation, and progestational phase.
The menstrual cycle is complex and is controlled by many different glands and hormones that these glands produce. 
There are four phases of menstrual cycle; namely, menstruation, the follicular phase, ovulation and the luteal phase. 
6 0
3 years ago
What are the components of Adenosine Triphosphate (ATP)
Black_prince [1.1K]
ATP consists of three phosphates, a base (adenine) and a sugar (ribose).
6 0
3 years ago
3. Algae makes energy-rich carbon compounds through
Thepotemich [5.8K]

A complementary process in nature either adds (options 3, 6, and 7) or removes ( options 4 and 5) carbon dioxide from the atmosphere.

<h3>Complementary processes and it's benefits</h3>

The processes that leads to the addition of carbondioxide back to the atmosphere include the following:

  • The eruption of volcanoes.

  • Cellular respiration carried out by organisms to release energy from food molecules.

  • The use of gasoline to power cars

The processes that leads to the removal of carbondioxide from the atmosphere include:

  • The production of energy-rich carbon compounds through photosynthesis.

  • The dissolution of carbondioxide in rainwater.

Learn more about photosynthesis here:

brainly.com/question/19160081

5 0
2 years ago
Other questions:
  • Why, Tommy, oh why? Your ever-returning patient has fractured his femur really badly. This is going to be a lot of work. Can you
    13·2 answers
  • What are the dangers of eating unhealthy foods besides becoming fat?
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • 5 Points
    13·2 answers
  • Hello there can anyone help me?
    13·1 answer
  • How does Darwin’s Finches support the argument that genetic variation increases the survival rate of certain individuals in a po
    11·1 answer
  • What is the complementary DNA for TACGGCTTA
    11·1 answer
  • In the maternity ward, Mrs. Bright and Mrs. Light share a room. When they were ready
    10·1 answer
  • Please answer ASAP the right answer only no random ones thank you
    15·1 answer
  • Gluconeogenesis is a form of ___. Select one: a. metabolism b. catabolism c. anabolism d. hydrolysis
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!