1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddika [18.5K]
3 years ago
9

NO Assign oxidation numbers to each element in this compound.

Chemistry
1 answer:
marta [7]3 years ago
7 0

Answer:

N=+2

O=-2

Explanation:

The compound NO is electrically neutral.

Lets assign the oxidation number of nitrogen to be N. The oxidation number of oxygen (-2) is then used as a reference.

For the compound to have a zero charge,  sum of the oxidation numbers equals zero.

N+ (-2)=0

N=+2

O=-2

You might be interested in
Round to 4 significant figures 4,567,986
kipiarov [429]
4,568,000
there is the rounded of 4 figures

7 0
3 years ago
Read 2 more answers
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
2 years ago
Consider the following equilibrium system: 3O2(g)  2O3(g); Keq = 1 Which equation compares the concentration of oxygen and ozone
Rashid [163]
Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.

 <span>3O2(g) <--> 2O3(g); 

Keq = 1 = [O3]^2/[O2]^3 

So [O2]^3 = [O3]^2 

Thus A) is correct</span>
7 0
2 years ago
Read 2 more answers
Explain why the weight of an object changes if taken to the moon but not its mass​
avanturin [10]

Answer:

Because the gravitational force alters

Explanation:

3 0
2 years ago
When heating a solution to boiling on a hot plate, start by ___________. Then, turn the heat to ___________to start. If necessar
Aleonysh [2.5K]

Answer:

1. starting and stabilizing the stir function

2. a medium heat

3.turn up the heat setting

Explanation:

A chemical reaction can be defined as a chemical process which typically involves the transformation or rearrangement of the atomic, ionic or molecular structure of an element through the breakdown and formation of chemical bonds to produce a new compound or substance.

Some of the laboratory apparatus (equipment) used for conducting a chemical reaction are conical flask, Bunsen burner, beaker, tongs, crucible, round bottom flask etc.

When heating a solution to boiling on a hot plate, start by starting and stabilizing the stir function. Then, turn the heat to a medium heat to start. If necessary, turn up the heat setting after waiting about ten minutes without seeing boiling.

The safety precautions that must be taken when heating a solution to boiling on a hot plate;

I. A proper inspection of the round bottom flask for cracks, irregularities or any imperfection.

II. Ensure you avoid heating the flask while it is closed.

III. When suspending the flask on a hot plate, you should ensure that you use a clamp for stability.

5 0
3 years ago
Other questions:
  • What is the pressure exerted by 1.2 moles of a gas with a
    5·2 answers
  • How do i do quantitative observation on a hailstone
    11·1 answer
  • A solution was prepared by dissolving 195.0 g of KCl in 215 g of water. Calculate the mole fraction of KCl. (The formula weight
    11·1 answer
  • When dead plants and animals decay, they form??? <br> What do they form??
    6·1 answer
  • Are the intersection of any two half-planes necessarily a half-plane
    9·1 answer
  • Which is a chemical property of copper? A. ability to oxidize B. color C. odor D. freezing point
    6·1 answer
  • A student added 32.60 mL of 0.03020 M NaOH to a 20.0 mL sample of ginger ale before his sample turned pink. (a) How many moles o
    15·2 answers
  • Which unit can be used to express the rate of a reaction?
    13·2 answers
  • How many sublevels are in L energy level?
    9·2 answers
  • Sample Data - Grignard Reagents Reaction Characterization Type of reaction: choose the general type of reaction from the options
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!