1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ArbitrLikvidat [17]
3 years ago
5

Once two gas particles undergo an elastic collision, the particles

Chemistry
1 answer:
babunello [35]3 years ago
8 0
D. have not lose any kinetic energy I'm pretty sure
You might be interested in
The difference in the heights of the Hg columns in Diagram B is17 mm-Hg. If the atmospheric pressure is 769 mm-Hg, what is the p
Korvikt [17]

The pressure of the confined gas will be 769-17 = 752 mmHg

<h3>What is Manometer ?</h3>

Manometer is a U shaped instrument which is used to measure the pressure acting on a column of fluid , a difference in the pressure  in the two arms of the manometer causes the liquid to reach different heights.

The difference  in the heights of the Hg columns in Diagram B is17 mm-Hg.

the atmospheric pressure is 769 mm-Hg,

the pressure of the confined gas in mm-Hg = ?

The pressure of the confined gas will be 769-17 = 752 mmHg

To know more about Manometer

brainly.com/question/18354578

#SPJ1

3 0
2 years ago
How many covalent bonds are in a nitrogen molecule?
makvit [3.9K]
3 covalent bonds (there are 2 electrons in the first orbital and 5 in the second. You still have room for three more)
7 0
3 years ago
Determine the mass of 4.25x10^26 formula units of barium hydroxide​
Andru [333]

4.25x10x^{26}

5 0
3 years ago
Please help fast. I will give brainliest.
Sonbull [250]

Answer:39 min

Explanation:

5 0
2 years ago
The standard unit for concentration, Molarity (M) can also be written as?
emmasim [6.3K]

mole is the standardized form of molarity

8 0
2 years ago
Other questions:
  • Which liquid would be the most difficult to raise or lower the temperature of
    13·2 answers
  • Why were atoms deflected in rutherfords gold foil experiments?
    10·1 answer
  • What are the kingdoms of eukaryotes
    12·1 answer
  • What term refers to columns of elements?
    14·1 answer
  • Chemical changes ________ involve the breaking and making of chemical bonds.
    14·1 answer
  • Geologists apply various methods to study the layers of the earth. Which if the following is a method used to study the deaths l
    6·1 answer
  • An object is placed at 0 on a number line. It moves 3 units to the right, then 4 units to the left, and then 6 units to the righ
    14·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • What are the atomic and mass numbers for the periodic table of elements
    8·1 answer
  • The pH of solution A is 7 and the pH of solution B is 5. Solution A has ____ times ______ hydrogen ion concentration compared to
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!