AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Early in mitosis, during prophase and prometaphase, the nucleus, nucleolus and nuclear envelope begin to dissolve in preparation for cell division. During telophase, which is the final stage in mitosis,, there is a reversal of effects of prophase and prometaphase; nucleus, nucleolus and nuclear envelope are again formed.
In DNA, there is a code for the sequence
of three bases for the placement of certain amino acid in a protein chain.<span> The amino acid chain that can be produced by
the DNA base sequence of C-A-A-G-T-T-A-A-A-T-T-A-T-T-G-T-G-A would be based on
the DNA code CAA is valine, GTT is glutamine, AAA is phenylalanine, TTA is asparagine,
TTG is asparagine and TGA is threonine. </span>
Answer:
B. The carbon cycle
Explanation:
In the carbon cycle, carbon in the atmosphere is absorbed into plants, where the plants use photosynthesis to convert that carbon into oxygen and energy for themselves. Neither of the other cycles involves a plant taking in a gas directly from the atmosphere.
Hopefully this was helpful! :)
I would say that your correct answer is B
