1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
3 years ago
13

3) If an electrical appliance has 150.0 V applied causing a current of 2.34 amps, what is the

Chemistry
1 answer:
ASHA 777 [7]3 years ago
5 0

Answer:

The resistance would be 64.10 ohms.

have a nice day my dude

You might be interested in
Which list correctly aligns the levels of organisms from the least to the most complex? A. organ → system → tissue → cell B. tis
enyata [817]
It should be D, cells are parts, tissue is part and organ is part of a system.

6 0
2 years ago
Read 2 more answers
When do electrons release photons​
Inessa05 [86]

Answer:

Later when they are older

Explanation:

brainliest/

3 0
2 years ago
How did modern scientists experiment with Van Goghs paints to determine their chemical reactions?
Vlada [557]

Answer:

the would test random expirements

7 0
2 years ago
What are the products obtained in the electrolysis of molten nai?
yanalaym [24]
Answer is: sodium (Na) and iodine (I₂).

<span> First ionic bonds in this salt are separeted because of heat: 
</span>NaI(l) → Na⁺(l) + I⁻(l).

Reaction of reduction at cathode(-): Na⁺(l) + e⁻ → Na(l) /×2.

2Na⁺(l) + 2e⁻ → 2Na(l).

Reaction of oxidation at anode(+): 2I⁻(l) → I₂(l) + 2e⁻.

The anode is positive and the cathode is negative.


4 0
3 years ago
How are nymphs different from adult insects?
umka2103 [35]

Answer:

Explanation:

the nymph looks like a smaller version of the adult insect, & it also has no wings & molts.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Question 5
    10·1 answer
  • Which of the following is the best explanation for a covalent bond?
    11·1 answer
  • Most stable monatomic ion formed from fluorine
    7·1 answer
  • How can i separate water salt starch​
    7·2 answers
  • 1. You return to the car from an all-day shopping spree at the mall.
    11·1 answer
  • What are some of the different substances that make up a pizza?
    14·1 answer
  • Why is it called endogenous process
    8·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Which position of Earth would give a
    11·1 answer
  • (01.07 LC)
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!