Answer:
The relative mass of electron is 0.0005
Explanation:
Atoms are the fundamental unit of matter. Every thing in the universe that occupy space and have mass is called matter. we can say that every matter is composed of atoms. while the atom is composed of subatomic particles called electron proton and neutron.
Subatomic particles Relative charge Relative mass
Proton +1 1
Neutron 0 1
Electron -1 0.0005
Electron:
The electron is subatomic particle that revolve around outside the nucleus and has negligible mass. It has a negative charge.
Symbol = e⁻
Mass= 9.10938356×10⁻³¹ Kg
electrical charge on electron= -1.6022 × 10⁻¹⁹ C
It was discovered by j. j. Thomson in 1897 during the study of cathode ray properties.
Proton and Neutron:
An atom consist of positively charged central core (nucleus) that is made up of Proton and neutron. Proton has positive charge while neutron is electrically neutral. Proton is discovered by Rutherford while neutron is discovered by James Chadwick in 1932.
Symbol of proton= P⁺
electrical charge on proton= +1.6022 × 10⁻¹⁹ C
Mass of proton=1.672623×10⁻²⁷ Kg
Symbol of neutron= n⁰
Mass of neutron=1.674929×10⁻²⁷ Kg
electrical charge on neutron= 0
Answer:
65.08 g.
Explanation:
- For the reaction, the balanced equation is:
<em>2AlCl₃ + 3Br₂ → 2AlBr₃ + 3Cl₂,</em>
2.0 mole of AlCl₃ reacts with 3.0 mole of Br₂ to produce 2.0 mole of AlBr₃ and 3.0 mole of Cl₂.
- Firstly, we need to calculate the no. of moles of 36.2 grams of AlCl₃:
<em>n = mass/molar mass</em> = (36.2 g)/(133.34 g/mol) = <em>0.2715 mol.</em>
<u><em>Using cross multiplication:</em></u>
2.0 mole of AlCl₃ reacts with → 3.0 mole of Br₂, from the stichiometry.
0.2715 mol of AlCl₃ reacts with → ??? mole of Br₂.
∴ The no. of moles of Br₂ reacts completely with 0.2715 mol (36.2 g) of AlCl₃ = (0.2715 mol)(3.0 mole)/(2.0 mole) = 0.4072 mol.
<em>∴ The mass of Br₂ reacts completely with 0.2715 mol (36.2 g) of AlCl₃ = no. of moles of Br₂ x molar mass</em> = (0.4072 mol)(159.808 g/mol
) = <em>65.08 g.</em>
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
<h2>The answer is 3.0 mL</h2>
Explanation:
The volume of a substance when given the density and mass can be found by using the formula
From the question
mass of aluminum = 8.1 g
density = 2.7 g/mL
It's volume is
We have the final answer as
<h3>3.0 mL</h3>
Hope this helps you
