1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lady_Fox [76]
3 years ago
13

Science help

Biology
2 answers:
Thepotemich [5.8K]3 years ago
7 0
The answer for the first one is c. That's all I know.
never [62]3 years ago
5 0
<h2>Answer to Q1:</h2>

(d) by finding the absolute age of the rock

<h2>Explanation:</h2>

The relative age of a rock is not an exact number or age; rather it's the comparison of one rock or fossil to another to determine which one is older or younger. Scientists use carbon dating to calculate the age of a rock. Organic material from the rock is tested and that information is used to calculate the estimated age.


<h2> Answer to Q2:</h2>

C) Rock layers

<h2>Explanation:</h2>

The Fossil Record and Geologic Time Fossils of plants and animals are present in some rocks. These fossils contribute to our understanding of geologic time and they show us the time span when and how a civilization used to live.

<h2>Answer to Q3:</h2>

(c) They get a sense of the history of the area they are investigating.

<h2>Explanation:</h2>

Fossils scaled into rocks are fundamental to the geologic time scale. For instance rocks formed during the Proterozoic Eon may have fossils of relative simple organisms, such as bacteria, algae, and wormlike animals while Rocks formed during the Phanerozoic Eon may have fossils of complex animals and plants such as dinosaurs, mammals, and trees.  

<h2>Answer to Q4:</h2>

(a)the appearance and disappearance of groups of organisms

<h2>Explanation:</h2>

the appearance and disappearance of groups of organisms in different geological eras of earth history shows the time span of that era. This time span can be easily determined from the fossils present on sedimentary rocks because they show the family or group of those species which were present in that particular time period.

<h2> Answer to Q5:</h2>

(d)radioactive dating

<h2>Explanation:</h2>

Scientists use radioactivity techniques to determine the age of earth. As we know radioactive substances emit energy continuously and they have a certain half life period so calculating the half life period can show us the age of earth by comparing the half lives of different radioactive elements. For example in uranium-lead dating, for instance, the radioactive decay of uranium into lead proceeds at a reliable rate.

<h2>Answer to Q6:</h2>

(c)Sedimentary

<h2>Explanation:</h2>

Mostly sedimentary rocks like limestone and shale are the best options in the formation of fossils. Igneous rocks are formed directly from hot lava that is why they would not be able to preserve any remnants of living organisms that fall in it during its formation.

<h2>Answer to Q7:</h2>

The granite is older than the sandstone.

<h2>Explanation:</h2>

The principle of inclusions states that with sedimentary rocks, if inclusions  are found in a formation, then the inclusions must be older than the formation that contains them. So in simple words pieces of the older rock will be included in the younger rock therefore option B is the correct answer.


You might be interested in
Which include the male and female sex cells?<br> gametes<br> chromosomes<br> eukaryotes<br> diploids
rusak2 [61]

GAMETES is made up of the male and the female sex cells.

The female sex cell is called the ovum while the male sex cell is called sperm. When these two sex cells come together during fertilization they form the gamete, which is made up of diploid number of chromosomes. Gametes are normally formed through meiosis, during the cell division, the germ cell undergo two fission, which results in four gametes,

6 0
3 years ago
Read 2 more answers
Shortening has "partially hydrogenated vegetable oil" as an ingredient. This means that during processing the number of carbon-c
CaHeK987 [17]

Decreasing the number of double bonds, the resultant effect may be the SOLIDIFYING OF THE OIL AT ROOM TEMPERATURE.

8 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Please help please thank you
Misha Larkins [42]

Answer:

Hi there!

The correct answer is igneous rock.

Igneous rocks they are most likely to experience brittle deformation is termed as breaking of rocks.

5 0
3 years ago
Koala bears are restricted to living in a certain kind of habitat because they _____.
hodyreva [135]

The reason why Koala bears are restricted to live in a certain habitat is because they can only eat a certain type of eucalyptus leaf. These bears are indigenous to Australia. They are nocturnal and live in tropical where temperate eucalyptus forest can be found.

6 0
4 years ago
Read 2 more answers
Other questions:
  • The tundra only gets 10 inches of precipitation each year, on average. This is similar to which other biome? A- Desert B- Taiga
    9·1 answer
  • What is the difference between the axial and appendicular skeleton?
    14·1 answer
  • A report that indicates the average income of all citizens in Washington, D.C. is most likely an example of:
    14·1 answer
  • A tick feeding on a human is an example of
    15·1 answer
  • The amount of Thymine bases in a segment of DNA is 40%. What would be the amount of<br> Cytosine?
    8·1 answer
  • Which of the following organisms is a producer
    8·2 answers
  • Why is it important that professional organizations advocate for their members?
    10·1 answer
  • In which place are you most likely to find minerals formed by solution<br> crystallization?
    7·1 answer
  • This hormone is released very early and very late during the ovarian cycle: ____________
    11·1 answer
  • The _______ zone includes the alveoli, while the _______ zone includes the trachea.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!