1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
juin [17]
4 years ago
12

What is the average yearly rate of change of carbon-14 during the first 5000 years?

Chemistry
1 answer:
erica [24]4 years ago
5 0

Answer:

The average yearly rate of change of carbon-14 during the first 5000 years = 0.0004538 grams per year

Explanation:

Given that the mass of the carbon 14 at the start = 5 gram

At the end of 5,000 years we will have;

A = A_0 \times e^{-\lambda \times t}

Where

A = The amount of carbon 14 left

A₀ = The starting amount of carbon 14

e = Constant = 2.71828

T_{1/2} = The half life

\lambda = 0.693/T_{1/2}

t = The time elapsed = 5000 years

λ = 0.693/T_{1/2} = 0.693/5730 = 0.0001209424

Therefore;

A = 5 × e^(-0.0001209424×5000) = 2.7312 grams

Therefore, the amount of carbon 14 decayed in the 5000 years is the difference in mass between the starting amount and the amount left

The amount of carbon 14 decayed = 5 - 2.7312 = 2.2688 grams

The average yearly rate of change of carbon-14 during the first 5000 years  is therefore;

2.2688 grams/(5000 years) = 0.0004538 grams per year

The average yearly rate of change of carbon-14 during the first 5000 years = 0.0004538 grams per year.

You might be interested in
Why is atp an example of chemical potential energy?
marta [7]
Hello! I hope this helps

Answer: ATP ( adenosine triphosphate) is considered as the energy currency of the cell as it stores energy in the cell. It is an example of chemical potential energy because energy is stored in the high energy containing phosphoanhydride bond (between phosphate molecules in the ATP).
7 0
4 years ago
Based on the collision theory, which factors are likely to increase the rate of reaction? Select all that apply.
Alexus [3.1K]

Answer:

Option a

Explanation:

can u mark brainliest?

7 0
2 years ago
What are the rows of the periodic table called?
Gala2k [10]

Answer:

B. Groups

Explanation:

6 0
3 years ago
Read 2 more answers
Complete the statement<br>qxy- bxy+cxy= xy( )​
andrey2020 [161]

Answer:

xy (-b+c+q) is the answer to this

3 0
4 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
4 years ago
Other questions:
  • Why do you convert the grams to moles as opposed to just leaving it in grams?​
    14·1 answer
  • Charcoal (burned wood) that was used to make prehistoric drawings on cave walls in france was scraped off and analyzed. the resu
    8·1 answer
  • Explain in your own words how DDT moved through the environment starting with spraying the farm crops
    12·1 answer
  • What is the significance of an electronegativity difference of 1.7 between 2 atoms?
    11·2 answers
  • Hana fills a cup with sandy ocean water. She pours the mixture through a filter. What does she collect that passes through the f
    10·2 answers
  • How many protons are there in H2S ?
    5·1 answer
  • There are many lewis structures you could draw for sulfuric acid, h2so4 (each h is bonded to an o). part a what lewis structure(
    6·2 answers
  • On the calendar, the full moon is shown happening on the eleventh of the month. What moon would you see around the date shown wi
    9·1 answer
  • Which of the following is an example of a response to stimulus?
    6·2 answers
  • What’s the formula for sodium oxide
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!