1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alinara [238K]
3 years ago
7

A piece of solid Fe metal is put into an aqueous solution of Cu(NO3)2. Write the net ionic equation for any single-replacement r

edox reaction that may be predicted. Assume that the oxidation state of in the resulted solution is 2 . (Use the lowest possible coefficients for the reaction. Use the pull-down boxes to specify states such as (aq) or (s). If a box is not needed, leave it blank. If no reaction occurs, leave all boxes blank and click on Submit.)
Chemistry
1 answer:
Vinvika [58]3 years ago
8 0

Answer:

Fe(s) + Cu^2+(aq) ---> Fe^2+(aq) + Cu(s)

Explanation:

The ionic equation shows the actual reaction that took place. It excludes the spectator ions. Spectator ions are ions that do not really participate in the reaction even though they are present in the system.

For the reaction between iron and copper II nitrate, the molecular reaction equation is;

Fe(s) + Cu(NO3)2(aq)----> Fe(NO3)2(aq) +Cu(s)

Ionically;

Fe(s) + Cu^2+(aq) ---> Fe^2+(aq) + Cu(s)

You might be interested in
For each of the following substituents, indicate whether it withdraws electrons inductively, donates electrons by hyperconjugati
aleksandrvk [35]

Answer:

Br- Withdraws electrons inductively

       Donates electrons by resonance

CH2CH3 - Donates electrons by hyperconjugation

NHCH3- Withdraws electrons inductively

              Donates electrons by resonance

OCH3 -  Withdraws electrons inductively

              Donates electrons by resonance

+N(CH3)3 - Withdraws electrons inductively

                   

Explanation:

A chemical moiety may withdraw or donate electrons by resonance or inductive effect.

Halogens are electronegative elements hence they withdraw electrons by inductive effect. However, they also contain lone pairs so the can donate electrons by resonance.

Alkyl groups donate electrons by hyperconjugation involving hydrogen atoms.

-NHCH3  and contain species that have lone pair of electrons which can be donated by resonance. Also, the nitrogen and oxygen atoms are very electron withdrawing making the carbon atom to have a -I inductive effect.

+N(CH3)3 have no lone pair and is strongly electron withdrawing by inductive effects.

3 0
3 years ago
BRAINLIEST IF CORRECT
Tpy6a [65]

Answer:

Explanation:

He should use these for airborne sounds

MDF Fiberboard.

Gypsum Board.

Plasterboard.

Mineral Wool.

He should avoid using

6 0
2 years ago
Is a landslide an example of erosion or weathering
Shtirlitz [24]

Answer:

It is a example of erosion

Explanation: because pieces of rock erode making it unstable a causes a landslide

7 0
3 years ago
Which procedure(s) decrease(s) the random error of a measurement:
PolarNik [594]

Taking the average of more measurements decreases random error of measurement

Taking the average of many measurements is the most effective way to reduce random errors in a measurement. Because the certainty of the results grows as the number of data does, Less risk of random errors means that the value is more certain. Fewer measurements lead to less reliable data collection, which raises the likelihood of random errors.

The complete question is

Which procedure(s) decrease(s) the random error of a measurement: (1) taking the average of more measurements: (2) calibrating the instrument; (3) taking fewer measurements? Explain

To learn more about random errors:

brainly.com/question/14149934

#SPJ4

8 0
1 year ago
Bacteria multiply by what????
kozerog [31]
Bacteria multiply through binary fission. This process involves the division of a single cell into two identical daughter cells, and it starts when the DNA of a bacterium divides into two replicates. The bacterial cell splits into two daughter cells that have identical DNA to the parent cell.
3 0
3 years ago
Read 2 more answers
Other questions:
  • How does fermentation that causes dough to rise differ from fermentation in muscles?
    5·2 answers
  • What is the molar mass of magnesium chlorite (Mg(CIO2)2)?
    6·1 answer
  • Calculate the mass of ethylene glycol (C2H6O2) that must be added to 1.00 kg of ethanol (C2H5OH) to reduce its vapor pressure by
    13·1 answer
  • which of the following usually have lower melting points than ionic solids a) Atomic solids b) Molecular solids c) Network solid
    8·2 answers
  • In which place would you find the most organisms
    6·2 answers
  • 1. The atomic symbol of aluminum is written as 2713Al. What information do you get from it?
    10·1 answer
  • 26. Which type of element has properties that are intermediate between metals and nonmetals?
    12·1 answer
  • Suppose a disease wipes out most of the fox population in
    13·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • How does increasing the temperature of a liquid below the boiling point affect
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!