1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
telo118 [61]
3 years ago
9

An amoeba is a unicellular organism, which doesn’t have a stomach for digestion of food. How does food storage and digestion tak

e place in an amoeba?
Biology
1 answer:
worty [1.4K]3 years ago
7 0
Food storage and digestion take place inside a food vacuole in the cytoplasm of amoeba.<span> Once digested, it reaches each cell organelle.</span>
You might be interested in
Care sunt animalele care hibernează? Vă rog repede! Dau 100 de puncte :)
ankoles [38]

Answer:

<h3>MEE TOO I DONT UNDERSTAND THIS QUESTION!☡</h3>
3 0
2 years ago
In a population of plants, the allele for long stems (S) is completely dominant over the allele for short stems (s). If 35% of t
Sergio [31]

Answer:

The correct answer would be 48 percent.

It can be solved by using the Hardy-Weinberg equation.

p² +  2pq+ q²  = 1

p + q = 1

where, p² represents homozygous dominant's frequency that is, SS in this case,

q² represents homozygous recessive's frequency that is, ss in this case,

2pq represents heterozygous dominant's frequency that is, Ss in this case.

p represents dominant allele's frequency and q represents the recessive allele's frequency.

Now, the percentage of homozygous recessive or short stems is 35%. Therefore, the frequency of homozygous recessive would be 0.35.

Thus, the value of q² = 0.35

So, q = \sqrt{0.35} = 0.59 which is approximately equals to 0.6.

As p + q = 1 so, q = 1 - 0.6 = 0.4

The frequency of heterozygous (Ss) = 2pq = 2(0.6)(0.4) = 0.48

Hence, the frequency of heterozygous would be 48 percent.

8 0
3 years ago
Which is NOT found in a DNA molecule?
aalyn [17]
<span>uracil isnt found in DNA only RNA</span>
7 0
3 years ago
Read 2 more answers
(picture attached) please help I’ll give brainliest
Ostrovityanka [42]

The correct answer is Solid.

6 0
3 years ago
Read 2 more answers
WILL GICE BRAINLIEST!!
larisa86 [58]

The answer is; burning unleaded gasoline

Unleaded gasoline does not reduce carbon emissions. The lead was added to fuel ideally for vehicles to reduce the knocking of engines. Lead in its chemical structure also increased fuel octane levels. When lead was discovered to be a neurotoxin, it was banned as an additive in fuel in most countries.  


5 0
3 years ago
Other questions:
  • Put the steps of the carbon cycle in order using Step 1 as your starting point. Step 1: Bacteria, through nitrogen fixation and
    6·2 answers
  • Which substances contain carbon?
    14·2 answers
  • What is a gene?
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which of these polymers acts as an energy storage molecule?
    6·1 answer
  • When two parents heterozygous for genes for curly hair are crossed, what percent of their offspring would have curly hair? What
    6·1 answer
  • The cells of plants and animals share some but not all of the same organelles. What is one
    7·2 answers
  • Use the information in the table to answer the question.
    13·1 answer
  • Plz answer this true or false??
    11·2 answers
  • How long can you keep hard-boiled eggs in the refrigerator
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!