1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga55 [171]
3 years ago
11

Which best describe the isovolumetric contraction phase of the cardiac cycle?

Chemistry
2 answers:
cluponka [151]3 years ago
5 0
The name isovolumetric indicates that there is no change in volume that takes place and this only occurs when all of the valves within the heart are shut.
Zina [86]3 years ago
4 0
Isovolumentric contraction phase of the cardiac cycle is the stage at which isovolumentric contraction occurs, at this phase all of the four valves of the heart are closed.
You might be interested in
ASAP
sammy [17]

The answer is C.

The vast difference in electronegativity of the oxygen and hydrogen in water, the O-H bond is polar.

8 0
2 years ago
How many moles of neon atoms are there in a neon sign that has 2.4 * 20^ 24 atoms of neon? *
Whitepunk [10]

Answer:

4 moles of neon

Explanation:

Given data:

Number of moles of neon = ?

Number of atoms of neon = 2.4×10²⁴ atoms

Solution:

The given problem will solve by using Avogadro number.

It is the number of atoms , ions and molecules in one gram atom of element, one gram molecules of compound and one gram ions of a substance.

The number 6.022 × 10²³ is called Avogadro number.

For example,

18 g of water = 1 mole = 6.022 × 10²³ molecules of water

1.008 g of hydrogen = 1 mole = 6.022 × 10²³ atoms of hydrogen

For given neon atoms:

1 mol =  6.022 × 10²³ atoms

2.4×10²⁴ atoms × 1 mol / 6.022 × 10²³ atoms

0.4×10¹ mol = 4 mol

3 0
3 years ago
Please help me :( thank you so much and if you can show work I would really appreciate it
Katyanochek1 [597]

Answer:

D

Explanation:

On the left hand side there are a total of 4 hydrogen and 2 oxygen but on the right hand side there Is only 2 hydrogen and 1 oxygen

6 0
3 years ago
Why is it important for the pH of blood to remain constant?
lesya692 [45]
It is important for the pH of blood to remain constant because your blood would ionize and burn up if the pH wasn't constant. And if the pH was too high, bacteria ( good and bad, and foreign) would end up dying, as well as yourself.
8 0
3 years ago
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Other questions:
  • What does the “s” indicate in a 2s atomic orbital?
    11·1 answer
  • Identify the type of bonding, molecular geometry (shape), and intermolecular forces experienced by the compounds HF and HBr. Whi
    6·1 answer
  • Which unit is used for measuring atomic mass?
    8·2 answers
  • Ultrasound is used to break up kidney stones. How do sound waves break up kidney stones?
    5·1 answer
  • When a piece of zinc metal is carefully placed in a beaker of strong acid, bubbles form on the surface of the metal and begin to
    7·1 answer
  • In a chemical equation, which symbol should be used to indicate that a substance is in solution?
    14·2 answers
  • In a carbon dioxide molecule, a double covalent bond forms when the carbon atom shares what
    9·1 answer
  • How many moles of Fe3O4 are required to supply enough iron to prepare 0.472mol Fe2O3 ?
    13·1 answer
  • A.Characterize each of the following as
    14·1 answer
  • Dehydration of tertiary alcohols occurs by what mechanism?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!