The answer is
option D "CO." Co also known as
Cobalt is the 27th element on the periotic table. It was discovered in <span>1735, it's boiling point is 3200 k.</span>
Atomic mass: 58.9332
Protons: 27
Neutrons: 32
Electrons: 27
Hope this helps!
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer is: specific gravity of glucose is 1,02.
d(glucose) = 1,02 g/ml.
d(water) = 1,00 g/ml.
Specific gravity of glucose = density of glucose ÷ density of water.
Specific gravity of glucose = 1,02 g/ml ÷ 1,00 g/ml.
Specific gravity of glucose = 1,02.
Specific gravity<span> is the ratio of the </span>density<span> of a substance (in this case glucose) to the density of a reference substance (water).</span>
Molar mass Na = 23g/mol
46g = 456/2 = 2mol
1mol = 6.022*10^23 atoms
2mol = 2*6.022*10623
= 1.204*10^24 atoms
Answer:
c) acidic
Explanation:
pKa is a value which describes the acidity of a solution. The solution is pKa ≤ 25 which means that the solution is more acidic. The lower value of pKa tells us that the solution is more acidic but when the pKa value of solution increases the acidity of the solution is also decreases. Due to lower value of pKa, the acid in the solution is fully dissociates in water.-5 to 50 is the range of the value of pKa for different solutions.
