1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anni [7]
3 years ago
7

If an experiment produces 5 g but should have made 500 g, what is the percent yield?

Chemistry
1 answer:
hoa [83]3 years ago
7 0

Answer:

Percentage of yield = 1%

Explanation:

Given:

Amount of yield = 5g

Total amount of product = 500 gram

Find:

Percentage of yield = ?

Computation:

⇒ Percentage of yield = [Amount of yield / Total amount of product]100

⇒ Percentage of yield = [5g / 500g]100

⇒ Percentage of yield = [0.01]100

⇒ Percentage of yield = 1%

You might be interested in
When 0.200 grams of Al reacts with 15.00 mL of a 0.500 M copper(II) chloride solution, how many moles of solid Cu would be produ
Naddik [55]
When The balanced equation is:
2Al + 3CuCl2 ⇒3 Cu + 2AlCl3
So, we want to find the limiting reactant:
1- no. of moles of 2Al = MV/n = (Wt * V )/ (M.Wt*n*V) = Wt / (M.Wt *n)
        
where M= molarity, V= volume per liter and n = number of moles in the balanced equation.
by substitute: 
∴ no. of moles of 2Al = 0.2 / (26.98 * 2)= 0.003706 moles.
2- no.of moles of 3CuCl2= M*v / n = (0.5*(15/1000)) / 3= 0.0025 moles.
So, CuCl2 is determining the no.of moles of the products.
∴The no. of moles of 3Cu = 0.0025 moles.
∴The no.of moles of Cu= 3*0.0025=  0.0075 moles.
and ∵ amount of weight (g)= no.of moles * M.Wt = 0.0075 * M.wt of Cu
 = 0.0075 * 63.546 =0.477 g


3 0
3 years ago
You are a researcher for a golf club manufacturer. You are given two identical looking cubes of a metal alloy. You are informed
Rashid [163]

Answer:

C.Melt both cubes and look for a broader range of melting temperatures. The one that melts over a broader range of temperatures is the amorphous solid.

Explanation:

Amorphous solids is one that do not have a fixed melting points but melt over a wide range of temperature due to the irregular shape hence its name. Contrariwise crystalline solids, have a fixed and sharp melting point.

This comes in handy to solve the riddle. We can characterise the pair with the melting point property.

7 0
3 years ago
Based on the sign of E cell, classify these reactions as spontaneous or non spontaneous as written.? assume standard conditions.
sammy [17]
A electrochemical reaction is said to be spontaneous, if E^{0} cell is positive. 

Answer 1:
Consider reaction: <span>Ni^2+ (aq) + S^2- (aq) ----> + Ni (s) + S (s) 

The cell representation of above reaction is given by;
    </span>S^{2-}/S //  Ni^{2+}/Ni

Hence, E^{0}cell =  E^{0} Ni^{2+/Ni} -  E^{0} S/S^{2-}
we know that, {E^{0} Ni^{2+}/Ni  = -0.25 v
and {E^{0} S/ S^{2-}  = -0.47 v

Therefore, E^{0} cell = - 0.25 - (-0.47) = 0.22 v

Since,  E^{0} cell is positive, hence cell reaction is spontaneous
.....................................................................................................................

Answer 2: 
Consider reaction: <span>Pb^2+ (aq) +H2 (g) ----> Pb (s) +2H^+ (aq)
</span>
The cell representation of above reaction is given by;
    H_{2} /  H^{+} //  Pb^{2+} /Pb

Hence, E^{0}cell = E^{0} Pb/Pb^{2+} - E^{0} H_{2}/H^{+}
we know that, {E^{0} Pb^{2+}/Pb = -0.126 v
and {E^{0} H_{2}/ H^{+} = -0 v

Therefore, E^{0} cell = - 0.126 - 0 = -0.126 v

Since,  E^{0} cell is negative, hence cell reaction is non-spontaneous.

....................................................................................................................

Answer 3: 
Consider reaction: <span>2Ag^+ (aq) + Cr(s) ---> 2 Ag (s) +Cr^2+ (aq)
</span>
The cell representation of above reaction is given by;
    Cr/Cr^{2+} // Ag^{+}/Ag

Hence, E^{0}cell = E^{0} Ag^{+}/Ag - E^{0} Cr/Cr^{2+}
we know that, {E^{0} Ag^{+}/Ag = -0.22 v
and {E^{0} Cr/ Cr^{2+} = -0.913 v

Therefore, E^{0} cell = - 0.22 - (-0.913) = 0.693 v

Since,  E^{0} cell is positive, hence cell reaction is spontaneous
8 0
3 years ago
Read 2 more answers
The partial negative charge at one end of a water molecule is attracted to the partial positive
Neporo4naja [7]

Answer:

             Hydrogen Bond

Explanation:

                   Hydrogen bond interactions are formed between the hydrogen atom bonded to most electronegative atoms (i.e. F, O and N) of one molecule and most electronegative atom (i.e. F, O and N) of another molecule.

In this interaction the hydrogen atom has partial positive charge and electronegative atom has partial negative charge.

6 0
2 years ago
The table shows data for two groups of plants one grown with fertilizer and the other without fetalizer was the mean height of t
AleksAgata [21]

Answer:

What is the question?

Explanation:

6 0
2 years ago
Read 2 more answers
Other questions:
  • I'm trying to do question number 2.56
    9·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What evidence do you have that the slope of the natural logarithm plot will be the same for all ions of the same charge, and not
    7·1 answer
  • Would you expect lactic acid, ch3ch(oh)co2h ( in sour milk) or myristic acid, ch3(ch2)12co2h (used to make cosmetics) to be more
    9·1 answer
  • What is a hydrocarbon? What is a hydrocarbon? It is a molecule derived from hydrogen synthesis. It is a wet carbon atom It is an
    10·1 answer
  • What type of chemical reaction is the following? BaCl2(aq) + Na2SO4(aq)
    7·1 answer
  • What are valance electrons used for?
    13·2 answers
  • Label the picture, please
    13·2 answers
  • PLEASE HELP!! DUE IN 5 MINUTES!!!’n
    12·1 answer
  • 5 points
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!