1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataliya [291]
3 years ago
7

Which structure is part of the cell’s skeleton?

Biology
1 answer:
lawyer [7]3 years ago
4 0

Answer:

The correct answer is microfilaments.

Explanation:

The cytoskeleton of our play a significant role in providing mechanical support and maintaining the proper shape of the body cells.

      Cytoskeleton is composed of mitrotubules, microtubule and intermediate filaments.

       Microfilaments are also known as actin filaments that composed of actin polymer that interacts with myosin during muscle contraction.

     Microtubules also helps in cytokinesis,cell movement,maintenance of cell shape,cellular contraction and relaxation.

You might be interested in
In landlocked lakes, water is discharged primarily through _____. precipitation evaporation groundwater seepage rivers and strea
zloy xaker [14]
The correct answer is evaporation. Hope this helps
4 0
4 years ago
Read 2 more answers
In the example of adrenaline signaling used in the animation, suppose each amplification step produces hundredfold active molecu
sesenic [268]

Answer:

D. 1000000

Explanation:

Adrenaline signaling occurs when the the hormones clings to the cell surface of the Adrenaline receptor.

The total modified protein target molecules resulting from a single activated signal receptor is 1,000,000 and this results in the consumption of 100 molecules of Guanosine triphosphate (GTP) and 1,010,000 molecules of Adenosine triphosphate (ATP).

Read more on Brainly.com - brainly.com/question/14995672#readmore

5 0
3 years ago
In aerobic respiration, what is the direct source of energy that atp synthase uses to synthesize atp?
leonid [27]
For the answer to the question above asking <span>In aerobic respiration, what is the direct source of energy that ATP synthase uses to synthesize ATP?</span><span>I think this is Proton Gradient. It is t</span><span>he product of the electron transport chain. A higher concentration of </span>protons <span>outside the inner membrane of the mitochondria than inside the membrane is the driving force behind ATP synthesis.</span>
4 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Stabilize the ________ with two boards that extend from the upper thigh to the bottom of the foot.
Artyom0805 [142]
Stabilizing a LEG, once it is broken, by using 2 boards extending from the upper thigh to the bottom of the foot is a proper way to help an injured victim in the field.
7 0
3 years ago
Other questions:
  • Ftsz is a bacterial cytoskeletal protein that forms a contractile ring involved in bacterial cytokinesis. its function is analog
    15·1 answer
  • The specialized cells involved in sexual reproduction are called: zygotes
    10·2 answers
  • How old is the pecten gibbus? and how long was it around for?
    9·1 answer
  • Match the vocabulary words with the correct description. Question 4 options: water that falls from clouds to Earth’s surface cha
    13·2 answers
  • How are scientific question turned into investigation ?
    5·1 answer
  • What is fishery, and mention two classes of fish based on their habitat​
    14·1 answer
  • 1. When you graph the motion of an object, you put _______on the x-axis and __________ on the y-axis
    15·1 answer
  • Help pls :(( it would help me alot
    6·1 answer
  • ______is the largest sac between small and large intestine were cellulose of food is digested .
    15·1 answer
  • Mitochondria contain circular strands of _____, similar to that found in many prokaryotes.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!