Answer:
D
Explanation:
This sentence has the most sensory details or details giving more description of the 5 senses.
Hope this helps :)
Here’s the math for your answer, which is 3.3 L HCl
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Faster molecules have fewer collisions than slower molecules is True about molecular speed.
<h3>What is Molecular speed?</h3>
Molecular speed refers to the average distance gases or molecules travelled atca particular time rate.
It is valid in ideal gas, where the molecules do not interact with others.
Average molecular speed = Square root (3 (ideal gas constant) * (Temperature)/m)
Therefore, Faster molecules have fewer collisions than slower molecules is True about molecular speed.
Learn more about molecular speed from the link below.
brainly.com/question/14327643
Color change, temperature change, bubbling, state change
green to blue, hot to cold, bubbles (lol), and liquid to gas
