1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vikki [24]
2 years ago
9

Anthocyanin is a pigment that gives flowers and leaves purple colors. The M gene codes for a transcription factor (Myb) that pro

motes expression of an enzyme that produces anthocyanin. The W gene codes for a different enzyme (Chs) that allows anthocyanin to be deposited in plant leaves and flowers. The dominant phenotype is the production of functional Myb and Chs. Use this information to answer the following question. Plants that have the mm genotype do not show any purple color. What is the best explanation for why this is?
Biology
1 answer:
eduard2 years ago
4 0

Answer:

Anthocyanin is not produced in the plant cells

Explanation:

Anthocyanin is not produced in plant cells with the genotype mm.

As you can see from the question above, anthocyanin is responsible for the purple color of the flowers. Anthocyanin is encoded by the M gene, which is a dominant gene. Because it is a dominant gene, we know that it will be expressed in plants with the Mm and MM genotype, but will not be encoded by plants with the mm genotype. With this we can conclude that plants that have the mm genotype do not have purple color, because anthocyanin is not produced in the plant cells of these plants, since they do not have the M gene.

You might be interested in
Which type of electromagnetic wave has the shortest wavelength?
Aliun [14]
A X-rays I think this is the answer
7 0
1 year ago
Read 2 more answers
How does the body’s response to endocrine regulation differ from its response to nervous regulation?
Mamont248 [21]

Answer:

.

Explanation:

Endocrine system uses chemical signaling (slow)

Nervous system uses electrical signaling (fasr)

4 0
3 years ago
Organisms that complete the final breakdown and recycling of organic materials from
scoundrel [369]

Answer:

decomposers

Explanation:

These are heterotrophic organisms that feed on dead animals and plants, secretions, or discarded parts of living beings, that is, organic matter.

And they break it down into inorganic.

Thus, inorganic substances that can be reused in the process of photosynthesis are returned, recycled, to nature.

7 0
2 years ago
1<br> What are the two major divisions of the nerous system
postnew [5]

Answer:100% SURE PLZZ GIVE BRAINLIEST!!!!!!111

The nervous system consists of two major parts: the central nervous system and the peripheral nervous system.

Explanation:

In vertebrates it consists of two main parts, the central nervous system (CNS) and the peripheral nervous system (PNS). The CNS consists of the brain and spinal cord. The PNS consists mainly of nerves, which are enclosed bundles of the long fibers or axons, that connect the CNS to every other part of the body.

4 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • What does a scientist do if his experiment disproves his hypothesis
    11·2 answers
  • The number of protons determines the
    10·1 answer
  • Carbon-14 has a half-life of 5730 years. A sample of wood has been recovered by an archaeologist. The sample is sent to a labora
    13·1 answer
  • Fungus like Protista reproduce with
    10·1 answer
  • Plant and animal cells differ in a variety of ways. Plants have a special structure that helps them produce their own food. With
    9·2 answers
  • Identify the roles of reactants and products in chemical reactions​
    15·1 answer
  • A scientist is observing various phenomena in the environment. He wants to plot the position of various objects as a function of
    8·2 answers
  • In a muscle, which two substances
    15·1 answer
  • How much of a 100 gram sample of gold-198 is left after 810 days if it’s half life is 2.7
    12·1 answer
  • Explain the importance of scientific names.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!