1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kaheart [24]
2 years ago
5

How many different monochlorobutanes (including stereoisomers) are formed in the free radical chlorination of butane?

Chemistry
1 answer:
PolarNik [594]2 years ago
5 0
5 monochloro  derivative  will  be  yield  to when  2  methylbutane  react  with  chlorine.  4  carbon  atom  are  present  in  2  methylbutane  which  react  with  chlorine.  The  chiral  carbon  that is  carbon   anti bonding  react  with  chlorine  to   form  four  different  groups  around  it  hence  it  will  stereoisomer
You might be interested in
The balanced chemical equation for the complete combustion propane, C3H8 is: C3H8 + 5O2 → 3CO2 + 4 H2O How many moles of H2O wou
BartSMP [9]
4/5 × 0.200 moles= 0.160moles
8 0
3 years ago
Why are cells the building blocks of an organism.​
ladessa [460]

Answer:A cell is the smallest unit of life, also called the 'building blocks of life' because cells multiply and differentiate to form a multicellular organism as well as give rise to new organism by forming gametes or reproductive spores.

Explanation:

8 0
3 years ago
The lightest weight element that is not a gas
LUCKY_DIMON [66]

Answer:Lithium

Explanation:Lithium has 3 protons, and 4 neutrons making it the lightest element that isn't a gas.

5 0
3 years ago
Read 2 more answers
Cobalt-62 is a radionuclide with a half life of 1.5 minutes. What fraction of
fredd [130]

Answer:

1/16 is the answer.........

7 0
2 years ago
How many atoms are in a sample of 175 grams of sodium (Na)? The answer needs to be <br> a x 10^b
ValentinkaMS [17]
Atomic mass Sodium ( Na ) = 22.98 u.m.a

22.98 g ----------------- 6.02x10²³ atoms
175 g ------------------- ?? atoms

175 x ( 6.02x10²³) / 22.98 =

4.58x10²⁴ atoms of Na

hope this helps!

4 0
3 years ago
Other questions:
  • The table shows the percentages of hydrocarbons that are found in a sample of crude oil. Hydrocarbons Percentage Paraffins 30 Na
    10·2 answers
  • Calculate: (a) the weight (in lbf) of a 30.0 lbm object. (b) the mass in kg of an object that weighs 44N. (c) the weight in dyne
    9·1 answer
  • The characteristic bright-line spectrum of an atom is produced when
    14·1 answer
  • Which of the following statements is accurate
    10·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Many metals pack in cubic unit cells. The density of a metal and length of the unit cell can be used to determine the type for p
    7·1 answer
  • The structure of ozone most closely resembles 1. , a linear molecule with different lengths of chemical bonds. 2. , a bent molec
    6·1 answer
  • Adding a(n) [Select]<br> ' will slow down a chemical reaction.
    10·1 answer
  • If a 2kg bird is pushed by the wind with a force of 2N, how fast does the
    8·1 answer
  • The mass of a hypothetical planet is 1 100 that of the earth and it’s radius is 1 4 that of earth. If a person weighs 500 n on e
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!