1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allushta [10]
3 years ago
13

Kingdom animalia includes a major phylum known as chordata, which includes the sub-phylum vertebrata. This includes lions like t

he ones shown above. The remaining taxonomic levels for lions is: Mammalia, Carnivora, Felidae, Panthera, leo. For the lion, Felidae is the name given to which taxonomic level?
Biology
2 answers:
OlgaM077 [116]3 years ago
7 0
Family is the answer                                                         
<span />
liq [111]3 years ago
7 0

Answer:

The correct answer is- Family

Explanation:

All the organisms are classified into seven different taxonomic groups and these groups are kingdom, phylum, class, order, family, genus, species. The highest largest taxonomic level is the kingdom and the lowest and smallest is species.

Leo is the species, Panthera is the genus and Felidae is a family of lion. The order of lion is Carnivora, class is Mammalia, phylum is Chordata and kingdom is Animalia. Therefore Felidae is the family of lion at taxonomic level.

You might be interested in
You are growing plants hydroponically (rooted in an aqueous solution rather than soil). The solution for the control group of pl
Vlad1618 [11]

Answer:

E. The length of cells in the elongation and mature zones would be larger in the control group.

Explanation:

The length of cells in the elongation and mature zones would be larger in the control group this is because of the increase in the solute concentration of the hydroponic growth medium which excluded the roots.

This reduces the amount of water that moves into the root system of the plants and nutrients which imitate drought conditions, this imposed drought leads to a decrease in the plant growth.

3 0
2 years ago
Which biogeochemical cycle is directly associated with fossil fuels
vekshin1
Carbon cycle is associated with fossil fuels

4 0
3 years ago
During the process of photosynthesis,
TEA [102]

Answer:

d. less than 100% of the energy captured from sunlight is transformed into potential energy in the form of a hydrogen ion gradient and then into potential energy in the form of covalent bonds

Explanation:

Photosynthesis is process utilized by plants, several bacteria and protists to convert the light energy to chemical energy. So they utilize the photosynthesis as the powerhouse for the energy production. Heterotrophs like human that cannot synthesize their own food, use this converted form of energy by autotrophs.

During the light reaction of photosynthesis the photons from light are absorbed by photosystem I and II. These photons excites the electrons which flow through the electron transport chain from higher potential to lower potential. These electrons release the energy while moving from higher potential to lower potential which is utilized by H+ pump to pump the H+ to lumen of plastids from stroma and of course not the 100% energy is utilized some of the energy dissipates. . So this process causes the accumulation of high potential H+ ions across the membrane. These H+ ions are utilized for the production of ATP by ATP synthase complex when they flow back to lower potential across the membrane through ATP synthase complex.

The ATP and NADPH produced from light reaction are utilized to combine carbon molecules during dark reaction. The covalent bond is used to combine the carbon molecules and we know that combining carbon molecules stores energy in the form of covalent bond.

8 0
3 years ago
Read 2 more answers
There are several ways to carry a gun. The shoulder carry is a good choice:
Anna [14]

Answer:

yes soulder carry is acctually a good choice

Explanation:

8 0
3 years ago
While exploring in Mexico, a scientist found a strange organism in an extremely salty underground water source. The organism doe
VLD [36.1K]
Domain Archae.
I DID THAT QUESTION
4 0
3 years ago
Other questions:
  • ______ is the process of mitosis and cytokinesis produce two identical daughter cells
    12·1 answer
  • Enzymes are made of protein and a non protein therefore they can not be denatured? True or false?
    13·1 answer
  • Identity the elevation and the percentage of oxygen available at each elevation
    9·1 answer
  • Sister chromatids separate during _____.
    8·2 answers
  • How does bacteria evolve?
    5·1 answer
  • Once mRNA is made it travels
    9·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • Unit Test
    7·1 answer
  • Which 2 simple machines make up a latchkey
    10·1 answer
  • Give two function of the skull​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!