1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melisa1 [442]
3 years ago
7

Wendell Stanley discovered that the tobacco mosaic virus was not an organism, but was chemical in nature.

Biology
1 answer:
elena-14-01-66 [18.8K]3 years ago
5 0
Its true 
hope this helped
You might be interested in
A __________ is a set of parts that function together as a whole. A) biosphere B) climate zone C) system D) habitat
klio [65]

C) a system is a set of parts that function together as a whole

7 0
3 years ago
Protons and neutrons together form
Oksi-84 [34.3K]
A nucleus. Hope this helps.
8 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
As the peppered moth evolved over time, its wings changed from light to dark so that it could better
solong [7]
So that it could camouflage better.
3 0
3 years ago
Read 2 more answers
How should you test a hypothesis?
ddd [48]
By experimenting
hope this helps!!!


5 0
3 years ago
Other questions:
  • The doctor also ordered measurement of wally's na+ and k+ levels. how is the adrenal gland related to these?
    10·1 answer
  • the below shows the distribution of marks obtained by a group of students in a mathematics test............... The marks are : 5
    15·1 answer
  • All living things can be found in the biosphere atmosphere hydrosphere geosphere
    7·1 answer
  • How does the body's immune response operate to fight infection?
    10·2 answers
  • true or false: If there were no friction, a moving object would keep moving, even if no other force were applied to it.
    13·2 answers
  • Assessment of a client with diabetes reveals that the toes are dark in color and the skin is shrunken and wrinkled, with a clear
    11·1 answer
  • You have an organism with the following characteristics - it grows as single cells. It is heterotrophic and has a cell wall that
    12·2 answers
  • VISUAL ANALOGY The master plan of a building shows how to build and place important parts of the building, such as walls, pipes,
    8·1 answer
  • The atomic number of argon is 18 and its mass number is 40. Describe the number and type of particles
    11·1 answer
  • Plz help I need help
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!