1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dybincka [34]
4 years ago
11

Lysis is best describes as

Biology
1 answer:
nirvana33 [79]4 years ago
6 0

Answer:

The destruction of the cell by rupture of the cell wall or cell membrane.

Explanation:

Lysis refers to the breaking of the cell wall or cell membrane. Without the cell wall or cell membrane, the cell wouldn't be able to hold its structures or its shape anymore. You can think of it as a cell exploding without its cell wall or cell membrane.

You might be interested in
Write the function of these in your body. carbohydrates, protein, vitamin​
iris [78.8K]

Answer:

<h3>Carbohydrates </h3>

- is the main source of energy of your body. They help you fuel your brain, kidneys, heart muscles, and central nervous system.

<h3>Protein </h3>

- A lot of your body is protein. Your muscles are just about all protein, and most of your organs are protein. Many of the chemical reactions in your body are speeded up by other types of protein. Your body can make some of the components of protein by itself, and it must get some of the components from outside of the body.

You need protein daily for your tissue to repair itself, normal function, and perhaps to grow.

<h3>Vitamin</h3>

- Vitamins allow your body to grow and develop. They also play important roles in bodily functions such as metabolism, immunity and digestion.

5 0
3 years ago
50 points, need within next couple mins
ankoles [38]

Answer:

yes

Explanation:

look at the link I gave you :)

4 0
3 years ago
The pancreas is considered to be an __________ gland as it produces the hormones insulin and glucagon that released into the blo
ddd [48]

Answer:

1. Endocrine

2. Exocrine

Explanation:

The pancreas serves as both endocrine and exocrine gland.  

The pancreas is an exocrine gland as the pancreatic acini produce digestive enzymes that are delivered to the small intestine through a network of ducts. The glands that release their secretions by ducts are called exocrine glands.  

Islets of Langerhans scattered among pancreatic acini serve the endocrine part of the pancreas. The alpha cells of pancreatic islets secrete hormone glucagon while the beta cells of the islets secrete the hormone insulin directly in the bloodstream. Likewise, the delta cells of pancreatic islets secrete hormone somatostatin. The ductless glands that release their secretions directly into the bloodstream are known as endocrine glands.

8 0
3 years ago
The main enzyme responsible for linking nucleotides during DNA replication is
lilavasa [31]
The answer is DNA polymerase
5 0
3 years ago
If an albino (aa) mates with a person homozygous for normal pigment (aa), select one:
geniusboy [140]
<span>One parent is an albino with the genotype aa (recessive homozygous), while another parent has genotype AA (dominant homozygous). If they mate:</span>  
<span>
Parents aa  x  AA</span> F1 generation: Aa Aa Aa Aa <span><span> 
This means that </span>c. all offspring are normal.</span>
<span>All of them are carriers of the albino allele (a), but albinism is expressed only when there are two recessive alleles.</span>
7 0
4 years ago
Other questions:
  • Which is a advantage of sexual reproduction over asexual reproduction
    9·2 answers
  • 14
    14·1 answer
  • Wisdom teeth are the third and final set of human molars that come in during the late teens or early twenties. In some cases, th
    9·2 answers
  • What are the differences between a plant and animal cell?
    8·1 answer
  • an animal cell on the left and plant cell on the right which two cell parts are most likely found in both types of cells
    9·1 answer
  • Wann erfolgte der Wurzel der Pflanzen
    9·1 answer
  • Question 5
    15·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Dress) write the process its raw material go through​
    10·1 answer
  • - These are gram- negative. Find the motile Coccobacilli from following.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!