1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga2289 [7]
3 years ago
5

The value of ΔH for the reaction below is -72 kJ. __________ kJ of heat are released when 1.0 mol of HBr is formed in this react

ion. H 2 (g) + Br 2 (g) → 2HBr (g)
Chemistry
1 answer:
eimsori [14]3 years ago
4 0

Answer:

36 KJ of heat are released when 1.0 mole of HBr is formed.

Explanation:

<em>By Hess law,</em>

<em>The heat of any reaction  ΔH  for a specific reaction is equal to the sum of the heats of reaction for any set of reactions which in sum are equivalent to the overall reaction:</em>

H 2 (g) + Br 2 (g) → 2HBr (g)         ΔH = -72 KJ

This is the energy released when 2 moles of HBr is formed from one mole each of H2 and Br2.

Therefore, Heat released for the formation of 1 mol HBr would be half of this.

Hence,

ΔHreq = -36 kJ

36 KJ of heat are released when 1.0 mole of HBr is formed.

You might be interested in
Calculate the empirical formula of a compound that has a composition of 5.9% (by mass) hydrogen and 94.1% (by mass) oxygen.​
adelina 88 [10]

Answer:

The empirical formula is the simplest form;

Given:

Oxygen O at 94.1% and

H at 5.9%

Assume 100grams.

94% = 0.941 x 100gm. = 94.1 gm x 1mole/16gm. = 5.88 moles of O

5.9% = 0.059 x 100gm. = 5.9gm. X 1moleH/1.002gm. = 5.88 moles of H

There is one mole of O for each mole of H so the empirical formula is O_1H_1

and written as OH.

8 0
3 years ago
Read 2 more answers
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
C + 2H2 -&gt; CH4
ankoles [38]

Answer:

<u>C) 4</u>

Explanation:

<u>The reaction</u> :

  • C (s) + 2H₂ (g) ⇒ CH₄ (g)

       12g      4g             16g

Hence, based on this we can say that : <u>2 moles of hydrogen gas are needed to produce 16g of methane.</u>

<u />

<u>For 32g of methane</u>

  • Number of moles of H₂ = 32/16 × 2
  • Number of moles of H₂ = <u>4</u>
4 0
2 years ago
Read 2 more answers
When will a seed begin to germinate?
Vlada [557]
When it has sunlight and water
4 0
3 years ago
Read 2 more answers
Elemental iodine (I 2) is a solid at room temperature. What is the major attractive force that exists among different I 2 molecu
Ulleksa [173]

Explanation:

As I_{2} is a covalent compound because it is made up by the combination of two non-metal atoms. Atomic number of an iodine atom is 53 and it contains 7 valence electrons as it belongs to group 17 of the periodic table.

Therefore, sharing of electrons will take place when two iodine atoms chemically combine with each other leading to the formation of a covalent bonding.

Hence, weak forces like london dispersion forces will be present between a molecule of I_{2}.

The weak intermolecular forces which can arise either between nucleus and electrons or between electron-electron are known as dispersion forces. These forces are also known as London dispersion forces and these are temporary in nature.

thus, we can conclude that london dispersion force is the major attractive force that exists among different I_{2} molecules in the solid.

7 0
3 years ago
Other questions:
  • When fe(no3)2(aq) and na2s(aq) are mixed, what is the black coloured precipitate that forms?
    10·1 answer
  • What is a chromosome
    12·2 answers
  • If two atoms are isotopes of the same element the atoms must have
    9·2 answers
  • 1.
    5·2 answers
  • Ba(NO3)2<br> What’s the atomic mass
    9·1 answer
  • Define the concentration measurements of parts per million
    5·1 answer
  • BRAINLIEST!!!!!!! LOTS OF POINTS!!!!!!
    7·1 answer
  • The functional groups in an organic compound can frequently be deduced from its infrared absorption spectrum. A compound exhibit
    12·1 answer
  • A laboratory assistant needs to prepare 35.2 liters of hydrogen at 25.0°c and 101.3 kilopascals. this is the equation for the re
    13·1 answer
  • Which is the correct mole ratio of
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!