Answer:
The empirical formula is the simplest form;
Given:
Oxygen O at 94.1% and
H at 5.9%
Assume 100grams.
94% = 0.941 x 100gm. = 94.1 gm x 1mole/16gm. = 5.88 moles of O
5.9% = 0.059 x 100gm. = 5.9gm. X 1moleH/1.002gm. = 5.88 moles of H
There is one mole of O for each mole of H so the empirical formula is 
and written as OH.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
<u>C) 4</u>
Explanation:
<u>The reaction</u> :
- C (s) + 2H₂ (g) ⇒ CH₄ (g)
12g 4g 16g
Hence, based on this we can say that : <u>2 moles of hydrogen gas are needed to produce 16g of methane.</u>
<u />
<u>For 32g of methane</u>
- Number of moles of H₂ = 32/16 × 2
- Number of moles of H₂ = <u>4</u>
When it has sunlight and water
Explanation:
As
is a covalent compound because it is made up by the combination of two non-metal atoms. Atomic number of an iodine atom is 53 and it contains 7 valence electrons as it belongs to group 17 of the periodic table.
Therefore, sharing of electrons will take place when two iodine atoms chemically combine with each other leading to the formation of a covalent bonding.
Hence, weak forces like london dispersion forces will be present between a molecule of
.
The weak intermolecular forces which can arise either between nucleus and electrons or between electron-electron are known as dispersion forces. These forces are also known as London dispersion forces and these are temporary in nature.
thus, we can conclude that london dispersion force is the major attractive force that exists among different
molecules in the solid.