1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Troyanec [42]
3 years ago
9

How do I determine the flow rate of a liquid?

Chemistry
1 answer:
topjm [15]3 years ago
6 0
The flow rate of a liquid substance using any type of method is determined through the use of a type of measurement. It's often measured using velocity, an area or through the means of elapsed time. It's also called as continuity.
You might be interested in
CAN YOU PLEASE HELP ASAP​
Helga [31]
Your answer would be D you welcome !
7 0
3 years ago
Read 2 more answers
The best material to be used in making cooking pots handles is made of: a. Polypropylene b. Bakelite c. Rubber d. Polyethylene
frutty [35]

Answer:

b. Bakelite

Explanation:

Bakelite -

Bakelite is a form if plastic , and is the very first plastic synthesized .

The handles of the cooking utensils are used to hold the utensil firmly , and hence need not turn hot while cooking , and need to be strong enough to take care of the food .

Hence , the handle should be of the material which is poor conductor of heat and strong .

Hence , bakelite is used for making the handle.

6 0
3 years ago
Consider the balanced chemical equation for the combustion of methane (CH4).
Mrac [35]
<h3>Answer:</h3>

                  89.6 L of O₂

<h3>Solution:</h3>

The balanced chemical equation is as,

                                CH₄  +  2 O₂    →    CO₂  +  2 H₂O

As at STP, one mole of any gas (Ideal gas) occupies exactly 22.4 L of Volume. Therefore, According to equation,

             44 g ( 1 mol) CO₂ is produced by  =  44.8 L (2 mol) of O₂

So,

                  88 g CO₂ will be produced by  = X L of O₂

Solving for X,

                        X = (88 g × 44.8 L) ÷ 44 g

                        X = 89.6 L of O₂

5 0
3 years ago
Read 2 more answers
Which of these actions would increase heat transfer between two objects?
klasskru [66]

Heat transfer is the phenomenon that occurs when the two objects are in the vicinity of each other and by increasing the area of their contact. Thus, option B is correct.

<h3>What is heat transfer?</h3>

Heat transfer is a process that flows the heat from one system to another, and is because of the difference in the temperature of the two objects that are part of the system.

The methods like conduction, convection, and radiation transfer the heat from the surface area to the other object. The heat gets transferred from the area of high to the low temperature.

Therefore, option B. by increasing the surface area the heat transfer increases.

Learn more about heat transfer here:

brainly.com/question/17823456

#SPJ1

5 0
2 years ago
Which is not a compound? a)Gold b)water c)sugar D)silicon dioxide
sweet [91]
Gold is an element. Water is made from hydrogen and oxygen, and silicon dioxide is an oxide of silicon, consisting of <span> two oxygen atoms and one silicon</span>
8 0
2 years ago
Other questions:
  • Write a net ionic equation for the overall reaction that occurs when aqueous solutions of potassium hydroxide and phosphoric aci
    5·1 answer
  • Which alkaline earth metal is part of the reaction process of photosynthesis answers?
    7·1 answer
  • Consider the molar solubility of SrCO3 in 0.10 M Sr(NO3)2 versus in pure water. Ksp SrCO3 = 5.4 x 10-10 Which statement is true?
    11·1 answer
  • what is a measure of the amount of matter in an object while what is a measure of the force of gravity acting on an object
    5·1 answer
  • Methane gas is expanded from an initial volume of 20.5 L at 0.92 atm at 23oC to a final volume of 34.6 L. During the expansion t
    7·1 answer
  • Which of the following ideas helps explain the factors that affect island colonization of and species richness for a region?
    13·1 answer
  • Balance equation of calcium carbonate+water​
    7·2 answers
  • What is the formula for tin(III) sulfate​
    12·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Which phase has the lowest entropy?<br> O A. Aqueous<br> O B. Liquid<br> O C. Solid<br> O D. Gas
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!