1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Doss [256]
3 years ago
14

How does the two main factors of biomes contribute to species diversity?

Biology
1 answer:
Len [333]3 years ago
4 0
Climate includes temperature and precipitation, and it determines growing season and soil quality. It is the major factor affecting the number and diversity of plants in terrestrialbiomes. By affecting plants, which arethe main producers, climate affects the biodiversity of terrestrial biomes.
You might be interested in
Every time a child visited a cousin who has two cats the child eyes turn red,itch and began to water then the child began to hav
viva [34]

the child has allergies or is allergic to the cat

3 0
3 years ago
The enzyme pepsin is produced in the cells of the stomach but not in the cells of the small intestine. The small intestine produ
kkurt [141]

Answer:

D) Expressed in the stomach, but not in the cells of the small intestine

Explanation:

6 0
3 years ago
Imagine an animal cell lost half of its mitochondria. Explain how the cell would be different.
seropon [69]

Answer:

Without mitochondria (singular, mitochondrion), higher animals would likely not exist because their cells would only be able to obtain energy from anaerobic respiration (in the absence of oxygen), a process much less efficient than aerobic respiration. ...

Explanation:

Mitochondria are rod-shaped organelles that can be considered the power generators of the cell, converting oxygen and nutrients into adenosine triphosphate (ATP). ATP is the chemical energy "currency" of the cell that powers the cell's metabolic activities. This process is called aerobic respiration and is the reason animals breathe oxygen. Without mitochondria (singular, mitochondrion), higher animals would likely not exist because their cells would only be able to obtain energy from anaerobic respiration (in the absence of oxygen), a process much less efficient than aerobic respiration. In fact, mitochondria enable cells to produce 15 times more ATP than they could otherwise, and complex animals, like humans, need large amounts of energy in order to survive.

mitochondrion is different from most other organelles because it has its own circular DNA (similar to the DNA of prokaryotes) and reproduces independently of the cell in which it is found; an apparent case of endosymbiosis. Scientists hypothesize that millions of years ago small, free-living prokaryotes were engulfed, but not consumed, by larger prokaryotes, perhaps because they were able to resist the digestive enzymes of the host organism. The two organisms developed a symbiotic relationship over time, the larger organism providing the smaller with ample nutrients and the smaller organism providing ATP molecules to the larger one. Eventually, according to this view, the larger organism developed into the eukaryotic cell and the smaller organism into the mitochondrion.

in most animal species, mitochondria appear to be primarily inherited through the maternal lineage, though some recent evidence suggests that in rare instances mitochondria may also be inherited via a paternal route. Typically, a sperm carries mitochondria in its tail as an energy source for its long journey to the egg. When the sperm attaches to the egg during fertilization, the tail falls off. Consequently, the only mitochondria the new organism usually gets are from the egg its mother provided. Therefore, unlike nuclear DNA, mitochondrial DNA doesn't get shuffled every generation, so it is presumed to change at a slower rate, which is useful for the study of human evolution. Mitochondrial DNA is also used in forensic science as a tool for identifying corpses or body parts, and has been implicated in a number of genetic diseases, such as Alzheimer's disease and diabetes.

i hope this is helpful

have a grest day!!:))

6 0
3 years ago
What Indian subcontinent is an accreted crustal block known as ___
Darina [25.2K]

Answer:

Peninsula

Explanation:

A peninsula is mostly surrounded by mass around most of its coastline. It can also be referred to as a headland. The part that is not surrounded is connected to the larger continental landmass. Another example of the peninsula is the Korean peninsula and the Floridian Peninsula.

7 0
3 years ago
When two atoms transfer electrons, the bond formed is called a/an _______ bond.
MissTica

Answer:

ionic bond

Explanation:

When two ions transfer electrons or bond together they make an ionic bond.

3 0
3 years ago
Other questions:
  • Why is the side of the Earth facing the moon pulled harder than the side facing away?
    6·1 answer
  • Human dna is spliced into the ___________, which is a small dna in bacteria.
    11·1 answer
  • Can you live without a pancreas?
    15·2 answers
  • A zoologist has been studying the annual migration of a species over a period of years. He missed the annual event on two occasi
    14·2 answers
  • What change in renal regulation of h+ would help compensate for a metabolic acidosis?
    5·1 answer
  • When chemical, transport, or mechanical work is done by an organism, what happens to the heat generated?
    10·1 answer
  • In bacteria, single polycistronic mRNA encodes for:
    10·1 answer
  • PLEASE HELP ME !!!
    14·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • if one parents blood type is AA and the other is Bb, is it possible for them to have a child with blood type O?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!