1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Inga [223]
3 years ago
5

What determines the genotype or an organism

Biology
2 answers:
Rudiy273 years ago
8 0

My best bet would be the answer C

nirvana33 [79]3 years ago
6 0
<h2>Answer </h2>

Option C is the best answer.

<u>Explanation </u>

Option C is the best one of all the given option. The genotype is the combination of alleles that transfer from parent cell to the offspring. There are three types of genotypes that are homozygous recessive, heterozygous and homozygous dominant. The genotype is responsible for the color of eyes acquired by the offsprings. The abnormal genotype is called the sickle cell cells that do not have enough amount of oxygen .

You might be interested in
Which type of tissue performs the role of signal conduction in the body? A. Connective tissue B. Epithelial tissue C. Muscle tis
Lyrx [107]
The answer is d., nervous tissue that promotes movement in the muscle tissue, triggers the brain on what muscle tissue needs to move, as in walking or lifting weights...

6 0
3 years ago
On the pH scale, a 7 indicates _____. <br> a base<br> an acid<br> neutrality
Bingel [31]
It would b Neutral,under 7 is acidic,higher than 7 is base
4 0
3 years ago
How do nutrients get to the cells in a flatworms solid acoelomate body?
wariber [46]
The nutrients get to the cells in a flatworms solid acoelomate body by diffusion process. Flatworms feed primarily on protozoa and bacteria, smaller worms and tiny organisms, dead or alive, that they come across. Based on the species of the flatworms , they also consume plant materials. They rely on diffusion to transport oxygen and nutrients to their internal tissues.
8 0
3 years ago
What should the food handler do before touching the chicken lettuce tomato and bun?
Anna71 [15]
Before the food handler handles any type of food or cooks and prepares them. It is best that they should properly wash their hands in order to prepare them with clean hands. It is best to wash the hands before handling the food so that the hand that could have exposed to dirt could be cleaned and it will prevent the food from being contaminated.
8 0
4 years ago
A sperm and egg are each _________. They fuse during fertilization to produce a _________ cell. A sperm and egg are each _______
blsea [12.9K]

Answer:

3. haploid; diploid

Explanation:

Sperm is male gamete or often called male reproductive cell. During the process of spermatogenesis, reductional division (meiosis) occurs in the spermatocytes and spermatids are formed which further mature to sperms. Thus as a result of meiosis, their chromosome number is reduced to half and thus they become haploid cells. During oogensis, eggs are also formed as a result of meiosis which reduces the chromosome number and so eggs are also haploid.

When during fertilization, these two haploid nucleus of these cells fuse together, they form a diploid zygote.

6 0
4 years ago
Other questions:
  • What is meiosis? plz help
    15·2 answers
  • How does the water inside plants return to the atmosphere?
    6·2 answers
  • What is the differences between gmo and transgenic cell?
    5·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Anders owns a struggling coffee shop and has just received devastating news: a nationally known competitor is moving in on the s
    13·1 answer
  • Which of the following months would be the darkest at the South Pole?
    9·1 answer
  • Enzymes function most efficiently at the temperature of typical cell which is about 37 degrees Celsius. Increases or decreases i
    11·1 answer
  • Which is the greatest consequence of transcription being blocked in the nucleus
    5·1 answer
  • Cell division is regulated by two major genes. ___________ stimulate cell division and ___________ inhibits cell division
    13·1 answer
  • Select the positive impacts of technology on animal agriculture.
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!