Answer no 8:
The correct option is D) Antelopes with muscular legs are bale to outrun their predators better than antelopes with poor muscle tone. Thus they lived to reproduce.
Explanation:
Genetic variations in a population are the main reason that natural selection tends to occur. Natural selection favours those organisms which have better characteristics.The organisms with better traits are able to reproduce and pass on their characteristics to their offsprings.
Answer No 10:
The correct option is A) Phenotype directly influences the interaction of an organism with its environment.
Explanation:
The interactions between the phenotypic traits and the environment analyze whether a particular organism will be able to survive and pass on its characteristics to its offspring. Hence, the phenotype directly influences the interaction of an organism with its environment.
Answer No 9
The correct option is A) resistance to a virus
Explanation:
Mutations can be described as any changes which occur in the DNA of an organism. Mutations might be beneficial or harmful depending on the location where the mutation arises. Viruses are usually harmful for eukaryotes. Hence, the correct option is A.
Answer No 11:
The correct option is C) Giraffes with longer necks survived because they were better suited to the environment.
Explanation:
Natural selection tends to favour those organsims which are better suited to live in an environment. Those organisms with better characteristics are able to survive and pass on their traits to their offsprings.
The giraffes with longer necks were better adapted to live in the environment and hence were favoured by natural selection.
Answer No 12:
The correct option is D) selective breeding
Explanation:
Selective breeding can be described as a technique in which organisms with better characteristics are crossed, so that offsprings with better characteristics can be produced. Selective breeding is done by humans where as natural selection is done by the nature.
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
Answer:
the answer should be ( 50% pink and 50% orange )
for better understanding u can make a cross yourself
if you want me to show that then I can put an attachment.
Answer:
Even a slight reproductive advantage will eventually lead to the elimination of the less well adapted of two competing species.
Answer:
finches?
Explanation:
i did the test but i don know what you mean