Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Nuclear reactions involve a change in an atom's nucleus, usually producing a different element. Chemical reactions, on the other hand, involve only a rearrangement of electrons and do not involve changes in the nuclei.
<h3>What affects the rate of nuclear reactions?</h3>
Reactant concentration, the physical state of the reactants, and surface area, temperature, and the presence of a catalyst are the four main factors that affect reaction rate.
<h3>What is the main difference between chemical reactions and nuclear reactions?</h3>
Chemical reaction normally occurs outside the nucleus. Nuclear reaction happens only inside the nucleus. When chemical reactions occur elements hold their identity and the nuclei of atoms also remains unchanged. During nuclear reactions, the nuclei of atoms changes completely and new elements are formed.
Learn more about chemical reaction here:
<h3>
brainly.com/question/11231920</h3><h3 /><h3>#SPJ4</h3>
Answer:
Ok Hold up. I will answer after I think of question
Explanation:
The peripheral nervous system<span>, or </span>PNS<span>, consists of the nerves and ganglia outside of the brain and the spinal cord. The main </span>function of the PNS<span> is to connect the central </span>nervous system<span> (</span>CNS<span>) to the limbs and organs.</span>
Answer:
D. The equipment needed to accommodate the high temperature and pressure will be expensive to produce.
Explanation:
Hello!
In this case, for the considered reaction, it is clear it is an exothermic reaction because it produces energy; and therefore, the higher the temperature the more reactants are yielded as the reverse reaction is favored. Moreover, since the effect of pressure is verified as favoring the side with fewer moles; in this case the products side (2 moles of ammonia).
In such a way, the high pressure favors the formation of ammonia whereas the high temperature the formation of hydrogen and nitrogen and therefore, option A is ruled out. Since the high pressure shifts the reaction rightwards and the high temperature leftwards, we would not be able to know whether the reaction has ended or not because it will be a "go and come back" process, that is why B is also discarded. Now, since hydrogen and nitrogen would be the "wastes", we discard C because they are not toxic. That is why the most accurate answer would be D. because it is actually true that such equipment is quite expensive.
Best regards!
