Answer:
The answer to your question is 92.7%
Explanation:
Balanced Chemical reaction
3 Zn + Fe₂(SO₄)₃ ⇒ 2Fe + 3ZnSO₄
Molecular weight
Zinc = 65.4 x 3 = 196.2g
Iron (III) = 56 x 2 = 112 g
Proportions
196.2 g of Zinc ------------------ 112 g of Iron
20.4 g of Zinc ----------------- x
x = (20.4 x 112) / 196.2
x = 2284.8/196.2
x = 11.65 g of Iron
% yield = 
% yield = 0.927 x 100
% yield = 92.7
Answer:
Mass of solute = 0.0036 g
Explanation:
Given data:
Concentration of Cl⁻ = 15.0 ppm
Volume of water = 240 mL
Mass of Cl⁻ present = ?
Solution:
1 mL = 1 g
240 mL = 240 g
Formula:
ppm = mass of solute / mass of sample ×1,000,000
by putting values,
15.0 ppm = (mass of solute / 240 g) ×1,000,000
Mass of solute = 15.0 ppm × 240 g / 1,000,000
Mass of solute = 0.0036 g
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer: The molarity of the malonic acid solution is 0.08335 M
Explanation:
To calculate the molarity of acid, we use the equation given by neutralization reaction:
where,
are the n-factor, molarity and volume of acid which is 
are the n-factor, molarity and volume of base which is NaOH.
We are given:
Putting values in above equation, we get:
Thus the molarity of the malonic acid solution is 0.08335 M
