1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Georgia [21]
3 years ago
7

What are limiting resources important?​

Biology
1 answer:
ddd [48]3 years ago
3 0

Answer:

The limiting resource within an ecosystem determines the carrying capacity (indicated in ecology by the letter, “K”), which is the maximum number of individuals in a population that a habitat can support without environmental degradation.

Explanation:

You might be interested in
How to convert 2499 nucleotides to the number of amino acids?
melamori03 [73]

Answer:

833

Explanation:

A codon (3 nucleotides) codes for 1 Amino Acid, 2499 divided by 3 = 833.

4 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
_ are the group of organisms always found at the base of a food chain. explain why
Alecsey [184]

Answer:

Plants Plants are autotrophs, which means they produce their own food. They use the process of photosynthesis to transform water, sunlight, and carbon dioxide into oxygen, and simple sugars that the plant uses as fuel. These primary producers form the base of an ecosystem and fuel the next trophic levels.

Explanation:

If you like my answer than please mark me brainliest thanks

5 0
2 years ago
What is the water intake of gymnosperms​
ad-work [718]

Answer:

Check down

Explanation:

Gymnosperms, like angiosperms (the flowering plants), differ from seedless plants (like mosses and ferns) in not requiring water for sperm to swim in to reach the egg. This means that the movement of pollen (male gamete) to ovule (female gamete) in seed plants relies on airborne transport, not water transport.

5 0
3 years ago
Branliest Will Be Given!!!!!!!!!!!!!
grandymaker [24]
Question 1:  C.
Question 2: C.
Question 3: D.
Question 4: A.
Question 5: A.
5 0
4 years ago
Read 2 more answers
Other questions:
  • An unresponsive state from which a person can be aroused only briefly despite vigorous, repeated attempts is known as a _______.
    7·1 answer
  • Give 2 reasons for why meiosis is important for sexual reproduction
    11·2 answers
  • Match each step of the scientific method with its description
    5·1 answer
  • What is the name of the boundary where the lithosphereic plate descends beneath an overrriding plate
    8·1 answer
  • How can water affect the rock cycle?
    7·1 answer
  • The enzyme polynucleotide phosphorylase randomly assembles nucleotides into a polynucleotide polymer. You add polynucleotide pho
    15·1 answer
  • There is a block of genes in the order ABCDEFG on a chromosome. A duplication takes place between, but not including, genes B an
    12·1 answer
  • 1. What shellfish have segmented bodies?
    9·2 answers
  • Which respiratory substrate has a respiratory quotient of 0.5​
    11·1 answer
  • Any organism that eats other animals.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!