Answer:
833
Explanation:
A codon (3 nucleotides) codes for 1 Amino Acid, 2499 divided by 3 = 833.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
Plants Plants are autotrophs, which means they produce their own food. They use the process of photosynthesis to transform water, sunlight, and carbon dioxide into oxygen, and simple sugars that the plant uses as fuel. These primary producers form the base of an ecosystem and fuel the next trophic levels.
Explanation:
If you like my answer than please mark me brainliest thanks
Answer:
Check down
Explanation:
Gymnosperms, like angiosperms (the flowering plants), differ from seedless plants (like mosses and ferns) in not requiring water for sperm to swim in to reach the egg. This means that the movement of pollen (male gamete) to ovule (female gamete) in seed plants relies on airborne transport, not water transport.
Question 1: C.
Question 2: C.
Question 3: D.
Question 4: A.
Question 5: A.
