1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nadusha1986 [10]
4 years ago
15

What is an allele? ——————————

Biology
2 answers:
Mekhanik [1.2K]4 years ago
8 0

Answer:

Alleles are the variant or alternative form of gene present on the  homologous chromosome at a specific position, its function is to determine the genetic traits.

Explanation:

Alleles are an alternative form of the gene, and they are present on the homologous chromosome.

  • If the function of the allele is to code for a specific type of protein and to determine the genetic traits.
  • If the Alleles are the same they are called homozygous.
  • If the alleles are different they are called heterozygous.
  • If the allele is dominated it denoted by a capital letter, whereas recessive allele by small letters.
  • Example : flower color in the pea plants,dominant allele is purple and recessive one white allele.

MrRa [10]4 years ago
6 0

The definition of alleles are pairs or series of genes on a chromosome that determine the hereditary characteristics.

An example of an allele is the gene that determines hair color.

You might be interested in
San Diego, California has cooler temperatures than Phoenix, Arizona which is the at the same latitude but further inland. What c
Morgarella [4.7K]

Answer:

the sun and earth are in different places but im not 100% sure bout it

7 0
3 years ago
The stomach, liver, intestines, bladder, rectum, and reproductive organs are housed in the:
levacccp [35]

Answer:

D. Abdominopelvic cavity

4 0
3 years ago
A biologist discovered a young, four-legged animal. The animal had lungs, seemed to fertilize internally, and its outer surface
navik [9.2K]
The answer should be reptiles!

The characteristics of reptiles are:

1. They are four-legged

2. They have an outer covering of scales

3. They breathe with the aid of lungs

4. Although most reptiles lay eggs, some also give birth to live young (fertilise internally)!

I hope this helps! :)
6 0
3 years ago
Read 2 more answers
Why do planets and the moon shine so brightly if they do not produce light
Sophie [7]
The moon reflects light from the Sun, and the sun shines on the planets :)
3 0
3 years ago
Read 2 more answers
I NEED HELP PLEASE PLEASE PLEASE PLEASE PLEASE
Rama09 [41]

Answer:

Producers, primary consumers, secondary consumers, tertiary consumers

Explanation:

4 0
3 years ago
Other questions:
  • Why do you need a global perspective when planning for sustainable energy?
    5·1 answer
  • The plasma membrane separates the __________ from the __________. the plasma membrane separates the __________ from the ________
    15·1 answer
  • Q1:
    7·1 answer
  • Transgenic animals are produced by?
    8·1 answer
  • 5. Complete the equation for cellular respiration:<br> 602 +<br> 6CO2 +
    12·1 answer
  • What is the first amino acid in your protein
    13·2 answers
  • 9. What is common among amylase, rennin and
    14·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Who was the first known explorer to travel through present-day South Carolina?
    11·1 answer
  • Why does a solar eclipse happen?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!