The probe would need to bind to the site
<span>TTTTAGCCATTTACGATTAATCG
The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is </span><span>complementary and antiparallel to it.</span>
Answer:
false
Explanation:
Autotrophs, organisms that produce their own food, are the first trophic level. These include plants and algae. Herbivores, which eat autotrophs, are the second trophic level. Carnivores, organisms that consume animals, and omnivores, organisms that consume both plants and animals, are the third trophic level.
This is because they train extremely hard in order to sustain stamina and endurance so, their bodies don't get the chance to build muscle because they burn more than they consume.
Hey Buddy here is ur answer :
Precipitation reactions occur when cations and anions in aqueous solution combine to form an insoluble ionic solid called a precipitate. Whether or not such a reaction occurs can be determined by using the solubility rules for common ionic solids.
Hope it helps you ...
