1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Romashka [77]
3 years ago
6

How does a heat affect the chemical reaction? ​

Chemistry
2 answers:
patriot [66]3 years ago
6 0

Answer:

Increasing the temperature increases reaction rates because of the disproportionately large increase in the number of high energy collisions. It is only these collisions (possessing at least the activation energy for the reaction) which result in a reaction.

Explanation:

vitfil [10]3 years ago
4 0
What the first one said
You might be interested in
Propiedades Químicas del elemento Astato. por favor es urgente!
Zarrin [17]
I'm not to sure but try soy
4 0
3 years ago
Wuy Piolcululugu<br> Give the names of two organs in the chest.<br> 1. ...............<br> 2 m
Arada [10]

Answer:

The organs present inside the chest are :

1. The lungs

2. The heart

Explanation:

The chest cavity is also called as the thoracic cavity. It is the second largest hollow space of the body.In the bottom , it is enclosed by the diaphragm.

This cavity actually contain three space each round with mesothelium , pleural cavity and precardial cavity.

This contain the lungs , the tracheobronchial tree , the heart , the blood vessels which transport the blood between the heart and the lungs.

It also contain the esophagus .

Esophagus is the path through which the food passes from the mouth to the stomach.

8 0
3 years ago
Ethyl alcohol (ch3ch2oh) is/is not soluble in water. 1. is; all organic molecules are soluble in water. 2. is; ethyl alcohol exh
nata0808 [166]
Answer:
            Ethyl alcohol is soluble in water because <span>ethyl alcohol exhibits dipole-dipole and h-bonding interactions with water.

Explanation:
                   Ethyl alcohol and water are miscible in each other because both are polar in nature and "Like dissolves Like".
                   The bond between oxygen and hydrogen atoms, both in alcohol and water are polar in nature and results in intermolecular hydrogen bond interactions between them as hydrogen bonding results when hydrogen atom in one molecule directly attached to highly electronegative atoms like fluorine, oxygen and nitrogen forms interaction with higly electronegative atom of neighbor atom.</span>
5 0
3 years ago
Which of the following is the correct equation for photosynthesis​
Finger [1]

Answer:

6CO2 + 6H20 + ENERGY = C6H12O6 + 6O2

Explanation:

Carbon dioxide + water + energy from light produces glucose and oxygen

4 0
3 years ago
Match the image with the correct invention
PolarNik [594]

Answer:

1. Watt stream engine

2. McCormick reaper

3. Fulton steamboat

These are the correct answers.

Have A good day!!  :)

8 0
3 years ago
Read 2 more answers
Other questions:
  • The nahco3 is the limiting reactant and the hcl is the excess reactant in this experiment. determine the theoretical yield of th
    12·1 answer
  • What have scientists been able to use to create the Geologic Time Scale?
    6·1 answer
  • Please help me! Thank you!
    15·1 answer
  • What is the ROUNDED atomic number for this elements?
    9·1 answer
  • What is the product of this chemical reaction?<br>"Copper(II) Sulfate reacts with Potassium Iodide"​
    15·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What's an atom ?<br> Science
    5·2 answers
  • Two volatile liquids A (P A pure= 165 Torr) and B (PB pure= 85.1 Torr) are confined in a piston/cylinder assembly. Initially onl
    15·1 answer
  • Which solution has the higher boiling point: 42.0 g c2h6o2 in 0.500 kg of h2o or 35.0 g nacl in 0.500 kg of h2o?
    7·1 answer
  • In each of the following cases, is the concentration of acid before and after dissociation nearly the same or very different? Ex
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!