1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Debora [2.8K]
3 years ago
11

Which is the length to the nearest tenth of a centimeter of the cylinder

Biology
1 answer:
Alla [95]3 years ago
7 0
The answer would be 7.0
You might be interested in
A black chicken and a white chicken mate. The offspring has both black and white feathers. This is an example of
Setler79 [48]
A hybrid chicken because the offsprings traits were shared and therefor that chicken is a hybrid.
5 0
3 years ago
Read 2 more answers
Which condition is inherited as a dominant allele?
Nady [450]

Answer:

Huntington's disease

Explanation:

becase it is are caused by dominant alleles of a single gene on an autosome. Changes in chromosome number can lead to disorders like Down syndrome.

8 0
2 years ago
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
Which statement best describes organic and inorganic molecules?
castortr0y [4]

Answer:

<h2>The correct option is A) Organic molecules are common in food, and inorganic molecules are used in electronics. Explanation: Organic compounds can be described as compounds which are made up of carbon</h2>

Explanation:

<h2><u>PLEASE</u><u> MARK</u><u> ME</u><u> BRAINLIEST</u><u> AND</u><u> FOLLOW</u><u> ME</u><u> LOTS</u><u> OF</u><u> LOVE</u><u> FROM</u><u> MY</u><u> HEART</u><u> AND</u><u> SOUL</u><u> DARLING</u><u> TEJASWINI</u><u> SINHA</u><u> HERE</u><u> ❤️</u></h2>
8 0
3 years ago
What best summarizes the process of protein synthesis
Neko [114]
The synthesis<span> of </span>proteins<span> takes two step, transcription and translation. Transcription takes the information encoded in DNA and encodes it into mRNA, which heads out of the cell's nucleus and into the cytoplasm. During translation, the mRNA works with a ribosome and tRNA to synthesize </span>proteins<span>.</span>
6 0
3 years ago
Other questions:
  • What are the limiting factors in a habitat
    8·1 answer
  • List three components that together make up one nucleotide​
    11·1 answer
  • If a female fruit fly heterozygous for red eyes (XRXr) crossed with a white-eyed male (XrY), what percent of their offspring wou
    6·1 answer
  • The hydrogen and oxygen atoms held together by what bonds
    8·1 answer
  • 4. In a prairie ecosystem, nitrogen and other matter builds up in animal
    5·1 answer
  • Linnaeus used similarities in structure to determine relationships among organisms.
    13·1 answer
  • *
    8·1 answer
  • The cross section below represents a plunge pool that formed at the bottom of a waterfall.
    6·1 answer
  • Which of the following is not a specific adaptation?
    14·2 answers
  • What statement correctly describes the relationship among endocrine glands, target cells, water-soluble hormones, and lipid-solu
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!