1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kramer
2 years ago
13

Energy is used to combine amino acid building blocks in order to build a large protein. What type of reaction is this?

Chemistry
1 answer:
xenn [34]2 years ago
3 0

We have to know the type of reaction involves in building a large protein from amino acid.

The reaction involves is condensation reaction.

Protein is made up of amino acids. Amino acid is the building block of proteins. Amino acids combine by condensation reaction and forms  polypeptide linkages (-CONH-) after loss of small molecules like water.

You might be interested in
A- south<br> B- north <br> C-west<br> D- east <br> Help ASAP no links or I’m reporting
Agata [3.3K]

Answer:

east

Explanation:

5 0
2 years ago
Which statement about the scientific veiws is correct?
hammer [34]
I think the answer will be b cuh
4 0
3 years ago
What are the top 10 facts about animal cells
bija089 [108]
Nucleus
Dna
Rna
Cell membrane
Mitochondria
Vacuoles
Matter
Nuclear membrane
8 0
3 years ago
Select the supplements that are minerals.
Jet001 [13]
<h3> The supplements that are minerals are</h3>
  1. calcium
  2. sodium
  3. iron
  4. zinc

<u><em> Explanation</em></u>

  • calcium   and sodium  are major  minerals   which are required  by the body for

      calcium-  needed  for muscle,hearing bone and  for the support of synthesis and function of cells

     sodium-   is needed to control blood  pressure  and  also for proper  muscle and nerve  function

  • Zinc  and iron are  required   in trace and both are needed for good health



3 0
2 years ago
What is the temperature -71 oC expressed in Kelvin?<br> Group of answer choices
satela [25.4K]

Answer: 202.15

Explanation:

-71°C + 273.15

= 202.15K

5 0
3 years ago
Other questions:
  • 1) The spectrum of lithium has a red line of 670.8 nanometers. (Remember 1 m = 1 X 109 nm) a. Convert the nanometer to meter usi
    7·1 answer
  • Removing one electron from an atom results in the formation of an
    7·2 answers
  • PLZZZZ HELP!!!!!
    15·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Consider the reaction 2CO(g) + O2(g)2CO2(g) Using standard thermodynamic data at 298K, calculate the entropy change for the surr
    7·1 answer
  • What is the anion of the compound Cu(CH3COO)2?
    9·1 answer
  • The heat of vaporization for ethanol is 0.826 kJ/j. Calculate the heat energy in joules required to boil 45.65g of ethanol
    13·2 answers
  • Calculate the kinetic energy, in J/mole, of 1.00 mole of gaseous water molecules at room temperature (25.0ºC).
    10·1 answer
  • Which of the following most likely requires intermolecular forces?
    8·2 answers
  • What ion will be formed by the selenium atom shown below when it has a stable set of valence electrons?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!