Use slader.com it helps with all textbook work!
Atomic or hybrid orbital on the central br atom makes up the sigma bond between this br and an outer f atom in bromine trifluoride, brf3 is sp2 hybridization
Trigonal hybridization is another name for sp2 hybridization. It entails combining one's' orbital with two 'p' orbitals of equal energy to create a new hybrid orbital known as sp2. A trigonal symmetry combination of s and p orbitals that is kept at 120
One of the hybrid orbitals formed when one s orbital and two p orbitals are mathematically merged to form three new equivalent orbitals orientated toward the corners of a triangle is sp2 hybridization.
The only feasible molecule geometry for sp2 hybridized center atoms is trigonal planar. When all of the bonds are in place, the shape is trigonal planar as well.
To learn more about sp2 hybridization please visit -
brainly.com/question/6270186
#SPJ4
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
4.5 moles
Explanation:
One mole is equal to 6.022 x 10^23 atoms
2.71 x 10^24 atoms * 1 mol/ 6.022 x 10^23 atoms = 4.5 moles
