Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Moles of methanol = 9.27x10^24/6.02x10^23 = 15.398 moles.
Mass of methanol = moles of methanol x molar mass of methanol
= 15.398 x 32.042
= 493.38 grams.
Hope this helps!
Answer:
A, C and D are correct.
Explanation:
Hello.
In this case, since the relationship between the vapor pressure of a solution is directly proportional to the mole fraction of the solvent and the vapor pressure of the pure solvent as stated by the Raoult's law:
Since the solute is not volatile, the mole fraction of the solute is not taken into account for vapor pressure of the solution, therefore A is correct whereas B is incorrect.
Moreover, since the higher the vapor pressure, the weaker the intermolecular forces due to the fact that less more molecules are like to change from liquid to vapor and therefore more energy is required for such change, we can evidence that both C and D are correct.
Best regards.
Answer:
When an electron is hit by a photon of light, it absorbs the quanta of energy the photon was carrying and moves to a higher energy state. One way of thinking about this higher energy state is to imagine that the electron is now moving faster, (it has just been "hit" by a rapidly moving photon).
Explanation: pls mark brainliest :))
