The house wiring should be done parallel because, in parallel connection there will be more advantages than a series connection.
Let a house is wired in series and it contains a fan, tube light, TV, refrigerator. All the devices are connected in series. Now, due to some disturbance the fan speed working or it burned. Then since the connection was a series, due to one appliance failure causes the whole circuit to fail. If it is burned that means it making an open circiut. Then there will be no current flow in the circuit.
Now if it was a parallel connection as we know already, the parallel connection is nothing but individual appliances connected to the same line by tappings. That means there's no dependency of one appliance on another. So if an appliance fail or burns it doesn't effects the remaining appliances. And there will be uninterrupted supply to the healthy appliances can be achieved.
That’s why we use parallel for house wiring
Answer:
B) irreversible process
Explanation:
The process given here is irreversible.
The state in which all of the external forces acting upon an object are balanced; there is no acceleration. friction ..... quadrupling. doubling distance and quadrupling mass has the overall effect of the force
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
A redox reaction --> a reaction whereby oxidation & reduction occurs
Reduction:
Charge of Cl2 = 0
Charge of Cl- in NaCl = -1
Hence, since charge of Cl2 decreased from 0 in Cl2 to -1 in NaCl, reduction occured.
Oxidation:
Charge of Na = 0
Charge of Na+ in NaCl = +1
Hence, since charge of Na increased from 0 in Na to +1 in NaCl, oxidation occured.
Since both oxidation & reduction occured in the reaction, it is a redox reaction.
