1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivanshal [37]
3 years ago
5

Which of the following statements is true?

Biology
1 answer:
Luden [163]3 years ago
7 0
C.All living things are made of the same elements
You might be interested in
Single maploid cell (with genetic normation from only one parend surrounded<br> hard outer wall
Misha Larkins [42]

Answer:  spore a single haploid cell (with genetic information from only one parent surrounded by a hard, outer wall.

Explanation:

3 0
3 years ago
When larger meteorites hit earth, what do they create​
nasty-shy [4]

Answer:

divots or holes

Explanation:

they hit at a high speed and make a divot in the ground

5 0
3 years ago
Which molecules does a cell need from food to make these membrane
Yuliya22 [10]

Answer: The organic molecules required for building cellular material and tissues must come from food. Carbohydrates or sugars are the primary source of organic carbons in the animal body. During digestion, digestible carbohydrates are ultimately broken down into glucose and used to provide energy through metabolic pathways.

Hope this helps...... Stay  safe and have a Merry Christmas!!!!!!!! :D

3 0
3 years ago
The long, thin, wax-coated needles of conifers help the trees _____.
Stolb23 [73]
I believe it’s a. conserve water. the waxy coating doesn’t let as much water evaporate.
8 0
4 years ago
Explain why organizing your data in an understandable format helps you, and others, make sense of that data.
Simora [160]
<span>It allows us to easily locate the data and use it.It will make it easier to find and correctly identify your files, prevent version control problems when working on files collaboratively.organising will help the users to read the big data in simple and understandable manner.</span>
4 0
4 years ago
Other questions:
  • How has human interaction affected the Mississippi Delta?
    6·1 answer
  • 4. What are the advantages of a nonspecific defense?
    14·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Certain foraminifera (shelled protozoa) have inconsistent fossil records. Which mode of evolution do they represent?
    14·1 answer
  • What is the function of Cilia?
    9·1 answer
  • Which of the following would form an electrolyte solution?
    11·1 answer
  • What is the significance of the evolution of Hox gene clusters during vertebrate evolution?
    8·1 answer
  • A single-celled organism is found living in a deep sea vent at the bottom of the ocean in extremely hot water. If it is examined
    15·2 answers
  • The mean weight of pumpkins in a pumpkin patch is 10 lbs. From this population a group of pumpkins, all weighing 15 lbs, were se
    10·1 answer
  • What is the total amount of protein, in grams, Morgan will get after 7 weeks of eating the same food items for breakfast and lun
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!