1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Strike441 [17]
3 years ago
5

Case Ico-delete Highlights

Biology
1 answer:
Zolol [24]3 years ago
5 0

Answer:

The correct answer would be - polycystic kidney disease.

Explanation:

The given clinical picture or information suggests that it is most probably an infection that takes place in one or both the kidneys and leads to the setting of polycystic kidney disease.

The given symptoms such as abdominal or flank pain, recurrent UTIs, blood in the urine, and hypertension are characteristic symptoms of polycystic kidney disease. Cystic lesions found on abdominal ultrasound are a confirmation of the disorder.

The key disease of this polycystic disorder is Goodpasture syndrome which shows symptoms of both glomerulonephritis and pulmonary hemorrhages, and medullary sponge kidney disorder.

You might be interested in
Bicuspid valve prevents backflow into
kherson [118]

Are there any answer choices?.....

3 0
3 years ago
I am not good at bio aka life so i need help with 19 and 20
Vera_Pavlovna [14]

Answer:

#19 = The cell is an animal cell because it's missing the organelles required in plant cells(chloroplast, vacuoles, and the cell wall)

#20 = The mitochondria would be most likely to be affected because it's the powerhouse of the cell, provides energy, and imports proteins. I hope this helps.

Explanation:

3 0
3 years ago
What is a compound eye?
Dimas [21]
An eye consisting of an array of numerous small visual units, as found in insects and crustaceans.
6 0
2 years ago
PLEASE HELP ASAP IM TIMED!! 100 PTS WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST AND CORRECTLY
cestrela7 [59]

Answer: More than 99 percent of all organisms that have ever lived on Earth are extinct. As new species evolve to fit ever changing ecological niches, older species fade away. But the rate of extinction is far from constant. At least a handful of times in the last 500 million years, 75 to more than 90 percent of all species on Earth have disappeared in a geological blink of an eye in catastrophes we call mass extinctions.

Though mass extinctions are deadly events, they open up the planet for new forms of life to emerge. The most studied mass extinction, which marked the boundary between the Cretaceous and Paleogene periods about 66 million years ago, killed off the nonavian dinosaurs and made room for mammals and birds to rapidly diversify

8 0
3 years ago
Models are useful to scientists, but they can have drawbacks. For example, models can oversimplify a process or show only parts
ikadub [295]

Answer:

Here’s one possible answer:

Pros

Simple images make the process easy to understand.

The model accurately shows that protein synthesis has distinct stages.

Cons

The model doesn’t accurately show nucleotides in DNA and RNA.

The model doesn’t differentiate between the locations of processes. It fails to show which processes occur in the nucleus and which occur on the ribosome.

Explanation:

Edmentum answer.

4 0
2 years ago
Read 2 more answers
Other questions:
  • Order the taxa from largest (first) to smallest (fifth). 1. first domain 2. second order 3. third kingdom 4. fourth class 5. fif
    10·2 answers
  • How many days are in 22 weeks
    12·2 answers
  • How does photosynthesis balance the oxygen and carbon dioxide level in the atmosphere?
    8·1 answer
  • A ligand produces a response in a cell if it finds the right kind of
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Fill in the blank (this is not multiple choice)
    15·1 answer
  • Which feature is created by wave erosion?<br> O loess<br> O delta<br> O rill<br> O stack
    11·2 answers
  • Which statement best describes a dormant plant? *
    11·2 answers
  • Krebs Cycle is part of_______________ respiration.
    8·1 answer
  • Please answer this for me
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!