Answer:
0.109 g.
Explanation:
Equation of the reaction:
Na3PO4 + 3HCl --> 3NaCl + H3PO4
Number of moles of HCl = molar concentration × volume
= 0.1 × 0.04
= 0.004 mol.
By stoichiometry, 1 mole of Na3PO4 neutralises 3 moles of HCl. Therefore, number of moles of Na3PO4 = 0.004/3
= 0.0013 mol
Mass of Na3PO4 = molar mass × number of moles
= 0.0013 × 164
= 0.219 g
Since 50% of Na3PO4 was present in the sample. Let 100 g be the total mass of the substance
= 0.219 × 50 g/100 g
= 0.109 g.
Answer:
186.9Kelvin
Explanation:
The ideal gas law equation is PV
=
n
R
T
where
P is the pressure of the gas
V is the volume it occupies
n is the number of moles of gas present in the sample
R is the universal gas constant, equal to 0.0821
atm L
/mol K
T is the absolute temperature of the gas
Ensure units of the volume, pressure, and temperature of the gas correspond to R
( the universal gas constant, equal to 0.0821
atm L
/mol K
)
n
=
3.54moles
P= 1.57
V= 34.6
T=?
PV
=
n
R
T
PV/nR = T
1.57 x 34.6/3.54 x 0.0821
54.322/0.290634= 186.908620464= T
186.9Kelvin ( approximately to 1 decimal place)
Acid Rain is formed when chemicals in the air get into rain and up the acidity levels!!!!!!
Hope this helps guys!
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
B:GRANITE
Explanation:
<em>Granite is typical of a larger family of granitic rocks that are composed mostly of coarse-grained quartz and feldspars in varying proportions. These rocks are classified by the relative percentages of quartz, alkali feldspar, and plagioclase (the QAPF classification), with true granite representing granitic rocks rich in quartz and alkali feldspar. Most granitic rocks also contain mica or amphibole minerals, though a few (known as leucogranites) contain almost no dark minerals.</em>
<em>Granite is typical of a larger family of granitic rocks that are composed mostly of coarse-grained quartz and feldspars in varying proportions. These rocks are classified by the relative percentages of quartz, alkali feldspar, and plagioclase (the QAPF classification), with true granite representing granitic rocks rich in quartz and alkali feldspar. Most granitic rocks also contain mica or amphibole minerals, though a few (known as leucogranites) contain almost no dark minerals.Granite is nearly always massive (lacking any internal structures), hard, and tough. These properties have made granite a widespread construction stone throughout human history.</em>
sana tama
