1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jok3333 [9.3K]
3 years ago
9

What is accretion?????

Chemistry
2 answers:
Monica [59]3 years ago
8 0

Answer:

the process of growth or increase, typically by the gradual accumulation of additional layers or matter.

Explanation:

nasty-shy [4]3 years ago
4 0

Answer:

The process of growth or increase, typically by the gradual accumulation of additional layers or matter.

Explanation:

You might be interested in
True or false: different substances are made up of different types of atoms
Degger [83]
I would definitely say that's false.

hope this helps you!:-)
5 0
3 years ago
Read 2 more answers
What similarities and difference exist between electrons and neutrons? Consider charge, size, location and number.
Alborosie

<u>Charge:</u>

An electron has a negative charge and a <em>n</em>eutron has a <em>n</em>eutral charge.


<u>Size:</u>

Electrons have a really small mass whereas the neutron has a mass of about 1 amu.


<u>Location:</u>

Neutrons are found in center of an atom, but electrons are around it.


<u>Number:</u>

The number of electrons and neutrons in atom varies.

7 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
How many liters of C3H6O are present in a sample weighing 25.6 grams?
lawyer [7]

To Find :

Number of moles of C₃H₆O present in a sample weighing 25.6 grams.

Solution :

Molecular mass of C₃H₆O is :

M = (6×12) + (6×1) + (16×1) grams

M = 94 grams/mol

We know, number of moles of 25.6 grams of C₃H₆O is :

n = \dfrac{Given \ Mass \ Of \ C_3H_6O }{Molar\ Mass \ Of \ C_3H_6O }\\\\n = \dfrac{25.6}{94}\ mole\\\\n = 0.27 \ mole

Hence, this is the required solution.

4 0
3 years ago
A ----------------- is a repeating pattern of positive and negative ions.
Dennis_Churaev [7]
That would be ionic lattice.
4 0
3 years ago
Other questions:
  • Which expression is equal to the number of milliliters(mL)in 12.5 liters(L)?
    7·2 answers
  • Goal: Create a project that illustrates knowledge of the rock cycle and the three types of rocks. Step 1: Writing about the Rock
    13·2 answers
  • This is basic chemistry btw.<br> screen shoted it
    14·1 answer
  • You are given an unknown mixture containing NaCl and NaHCO3. When you carry out the heating exactly as described in part A, only
    6·1 answer
  • NEED HELP ASAP !
    7·2 answers
  • Which of the following correctly describes the decomposition of aqueous NaNO3?
    15·1 answer
  • 8. Why do we see water droplets on the outer surface of a glass containing ice cold water?
    14·2 answers
  • Explain chromatography​
    15·1 answer
  • How many molecules are in 41.8 g H2O?
    7·2 answers
  • Calculate the mass of copper that could be made from 4.0g of copper oxide
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!