1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dsp73
2 years ago
7

Observe this chemical reaction: 4 Fe + 302– 2Fe2O3 How many reactants are there ?

Chemistry
2 answers:
kirza4 [7]2 years ago
8 0

Answer:

2 Reactants

Explanation:

its the iron and oxygen

Veronika [31]2 years ago
8 0
2 because iron is one and oxygen is another.
You might be interested in
Which type of system must exist for chemical equilibrium
larisa86 [58]

Answer: closed system.

Explanation:

4 0
3 years ago
What is the specific heat of a substance if 690 J of heat are required to raise the temperature of a 100 g
tangare [24]

Answer:

hi

Explanation:

8 0
3 years ago
Why is it important for scientists to use a classification
Kobotan [32]
So they can tell what exact species it is. 
7 0
3 years ago
Which of these statements best compares the pair of line segments with the vertex?
liraira [26]

The line segment is describe  as a line which joints two points. The word segment is denotes the end points of the line. The symbol of the line segment is AB. This symbol is indicating a line from the point A to the point B.

  • Generally, the line segment has two endpoints. The meeting point of two line segments is called as the vertex and also it is considered as a common endpoint on the other hand line is a straight path of points that goes on and on in two directions
  • Vertex is a point where two rays meet OR where the sides of a polygon meet OR the point where three or more edges of a solid figure meet and the angle is Formed by two rays that have the same endpoint

To know more about line segment visit :

brainly.com/question/25727583

#SPJ9

3 0
1 year ago
Describe the difference between an independent and dependent valuable?
kolbaska11 [484]

Answer:

A dependent valuable is a valuable whose variation depend on another variable usually the independent variable. An independent variable is a variable whose variation do not depend on another variable but the reseacher experimenting.

7 0
3 years ago
Other questions:
  • Assume that 8.5 L of iodine gas (I2) are produced at STP according to the following balanced equation:2KI(aq) + Cl2(
    5·2 answers
  • Which physical property of water best allows solutes dissolved in it to be separated using simple distillation?
    13·2 answers
  • HELP i will give crown and 15 points
    7·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Relationship between the variables of Pressure and Temperature of a gas?
    5·1 answer
  • The reduction of iron(III) oxide (Fe203) to pure iron during the first step of steelmaking,
    7·1 answer
  • What must be changed, temperature or heat energy, during condensation explain in 2-3 sentences
    12·1 answer
  • Calculate the number of grams of aluminum chloride produced when 8.6 moles of aluminum react with chlorine gas.
    8·1 answer
  • A sample of gas has its number of molecules quadrupled, its Kelvin temperature doubled, and its volume tripled. By what factor h
    10·1 answer
  • Hydrogen peroxide is oxidized with permanganate solution to produce oxygen gas by the following reaction:
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!