1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brilliant_brown [7]
2 years ago
13

1. Multiple Choice

Chemistry
1 answer:
solong [7]2 years ago
5 0

Answer:

#1 A

#2 B

#3 C

#4 c

Explanation:

#1 can give reference to a mountain the higher the altitude the colder it will get

#2 talking about climate not seasons per say. focus on climate answers

#3 wind carry moisture from the sea on to land which cause precipitation

#4 Monsoons is correct

You might be interested in
PLEASE HELP ME ASAP!!! <br> I need the answer to #9. If you can show work please do.
scoundrel [369]

The correct answer would be 32/16s


7 0
3 years ago
What evidence is there that marker ink is a mixture
zheka24 [161]
Ink can be separated into black and other color pigments. This can be done on filter paper by dotting the marker just above the edge and adding ethyl alcohol, which drags the pigments separately across the paper.
5 0
3 years ago
Which of the following symbols represents a chlorine ion with a stable arrangement of eight valence electrons?
frozen [14]

A stable arrangement of eight valence electrons : ³⁵Cl⁻¹

<h3>Further explanation</h3>

Chlorine is a halogen gas, located in group 17, p block

Chlorine has an atomic number of 17 and an atomic mass of 35

Electron configuration: [Ne] 3s²3p⁵

If we look at the electron configuration, then Cl will bind 1 more electron so that the configuration is stable like Argon (atomic number 18)

So by binding this one electron, chlorine forms negative ions (anions)

³⁵Cl⁻¹

B. Cl⁻² binds 2 electrons, exceeding the octet rule

C. Cl⁺¹, releases 1 electron, remains unstable

D. Cl, the neutral form of Cl, is still unstable with a 7-electron valence configuration

3 0
3 years ago
A sample of sugar contains 1.505 × 1023 molecules of sugar. How many moles of sugar are present in the sample?
alisha [4.7K]
1 mole ------------ 6.02 x10²³ molecules
? mole ----------- 1.505 x10²³ molecules

1.505x10²³ / 6.02x10²³ => 0.25 moles

hope this helps!


4 0
3 years ago
What is the land like where mesosaurus fossils are found?
Veronika [31]

Answer:

They are found in South America and African Plates. Earths outer layer is made out of solid rock. These fossils are sometimes discovered closer to the mantle; the mantle is between the crust and the earths super-heated core!

Explanation:

Copy the answer and im sure you'll get it right!

Have a wonderful day/night and believe in yourself!

3 0
2 years ago
Read 2 more answers
Other questions:
  • It the mass of a material is 46 grams and the volume of the material is 8 cm ^3 What would the density of the material to be
    7·1 answer
  • For the following reaction, calculate how many moles of NO2 forms when 0.356 moles of the reactant completely reacts.
    6·1 answer
  • Part b an "empty" container is not really empty if it contains air. how may moles of nitrogen are in an "empty" two-liter cola b
    6·2 answers
  • 135-g sample of a metal requires 2.50 kJ to change its temperature from 19.5 C to 100.0 C what is the specific heat of this meta
    5·1 answer
  • Can you find a salmander in the desert or rainforest?
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which substance has a molar mass of 33.99 g/mol?
    14·1 answer
  • 3. Which muscle tissue lacks striations?
    14·1 answer
  • Covalent compounds..
    6·1 answer
  • What products would you expect from the reaction of ammonia and sulfuric acid in aqueous solution
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!