All categories

3 years ago

Write the balanced equation for the formation of the Grignard reagent from bromobenzene.

Chemistry

1 answer:

alexgriva [62]3 years ago

7 0

Answer:

hello your question is incomplete attached below is the complete question

Write the balanced equation for the formation of the Grignard reagent from bromobenzene. Include all reagents and products BUT NOT SOLVENTS.

answer : attached below

Explanation:

I mol mg + 1 mol bromobenzene = 1 mol Grignard

attached below is the balanced equation for the formation of the Grignard reagent from bromobenzene

You might be interested in

Why does mass decrease when sugar dissolved in water

kap26 [50]

Answer:

Because the same amount of sugar is still there. The solid sugar crystals break apart in water as the sugar dissolves, but the individual sugar particles or molecules are still present and do not change as a result of dissolving in the water. The combined mass of the sugar and water shouldn't change.

7 0

3 years ago

Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT

inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0

3 years ago

One of the steps in the commercial process for converting ammonia to nitric acid is the conversion of NH3 to NO: 4NH3 (g) 5O2 (g

madreJ [45]

Answer:

O2 is the limiting reactant.

Explanation:

Step 1: Data given

Mass of NH3 = 2.00 grams

Mass of O2 = 2.50 grams

Molar mass NH3 = 17.03 g/mol

Molar mass O2 = 32 g/mol

Step 2: The balanced equation

4NH3(g) + 5O2 (g) → 4NO(g) + 6H2O (g)

Step 3: calculate moles NH3

Moles NH3 = mass NH3 / molar mass NH3

Moles NH3 = 2.00 grams / 17.03 g/mol

Moles NH3 = 0.117 moles

Step 4: Calculate moles O2

Moles O2 = mass / molar mass O2

Moles O2 = 2.50 grams / 32 g/mol

Moles O2 = 0.0781 moles

Step 5: Calculate the limiting reactant

For 4 moles NH3 we need 5 moles O2 to produce 4 moles NO and 6 moles H2O

O2 is the limiting reactant. It will completely be consumed. (0.0781 moles). NH3 is in excess. There will react 4/5 * 0.0781 moles = 0.0625 moles

There will remain 0.117 - 0.0625 = 0.0545 moles NH3

O2 is the limiting reactant.

8 0

4 years ago

Which reflects more sunlight-dark soil or white sand?

Gnesinka [82]

I think the answer is white sand (sorry if i am wrong)

4 0

3 years ago

Read 2 more answers

29. What is E for a system which has the following two steps:

jasenka [17]

Answer:

Zero

Explanation:

Recall that;

E = q + w

Where;

q = heat, w = work done

When heat is absorbed by the system q is positive

When heat is evolved by the system q is negative

When the system does work, w is negative

When work is done on the system w is positive

Step 1

ΔE1= 60 KJ + 40 KJ = 100KJ

Step 2

ΔE2= (-30 KJ) + (-70 KJ) = (-100) KJ

ΔE1 + ΔE2= 100KJ + (-100) KJ = 0KJ

4 0

3 years ago