1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zepler [3.9K]
3 years ago
10

Give the ground-state electron configuration for each of the following elements. After each atom is its atomic number in parenth

eses. (a) Potassium (19) (b) Neon (10)How many electrons are in the valence shell of each atom ? (a) Visited um (AI) (b) Oxygen (O) (c) Fluorine (F)
Chemistry
1 answer:
Anni [7]3 years ago
3 0

Answer:

(a) ₁₉K: 1s² 2s² 2p⁶ 3s² 3p⁶ 4s¹

(b) ₁₀Ne: 1s² 2s² 2p⁶

---

(a) 3

(b) 6

(c) 7

Explanation:

We can state the ground-state electron configuration for each element following Aufbau's principle.

(a) ₁₉K: 1s² 2s² 2p⁶ 3s² 3p⁶ 4s¹

(b) ₁₀Ne: 1s² 2s² 2p⁶

Second part

(a) Al belongs to Group 13 in the Periodic Table. It has 13-10=3 electrons in the valence shell.

(b) O belongs to Group 16 in the Periodic Table. It has 16-10=6 electrons in the valence shell.

(c) F belongs to Group 17 in the Periodic Table. It has 17-10=7 electrons in the valence shell.

You might be interested in
PLEASE HELP WILL GIVE BRAINLIEST
Phoenix [80]

Answer:

Coefficients represents no of moles while subscripts represent no of atoms.

5 0
2 years ago
Read 2 more answers
Ignore, question was removed
djverab [1.8K]
Rip bro but I need the point
6 0
2 years ago
Which of the following will neutralize an acid?
pochemuha
LiOH is going to neutralize the acid because it’s a base
8 0
2 years ago
An experiment requires 0.52 M NH3(aq). The stockroom manager estimates that 15 L of the base is needed. What volume of 15 M NH3(
Bingel [31]

Answer: 0.52 L of 15 M NH_3(aq) will be used to prepare this amount of 0.52 M base.

Explanation:

But on diluting the number of moles remain same and thus we can use molarity equation.

C_1V_1(stock)=C_2V_2 (to be prepared)

where,

C_1 =concentration of stock solution = 15 M

V_1 = volume of stock solution = ?

C_2 = concentration of solution to be prepared = 0.52 M

V_2 = volume of solution to be prepared = 15 L

15\times V_1=0.52\times 15

V_1=0.52L

Thus 0.52 L of 15 M NH_3(aq) will be used to prepare this amount of 0.52 M base

8 0
2 years ago
1.) You have 4.2 moles of magnesium (Mg). How many atoms of magnesium do you have?
NNADVOKAT [17]
1) N = 4,2 moles
M = 24,31 u
m = N x M
= 4.2 x 24.31 = 102.102 kg


2) m = 54.9 grams = 0.0549 kilograms
M (Na) = 22.99 u
N (moles) = m / M
N = 0.0549 / 22.99 = 2.4 x 10^-3 moles

I don’t know if it helped you a bit :)
5 0
2 years ago
Other questions:
  • What things can the atomic radiation help us with
    12·1 answer
  • Answers section 4.2 structure of the nuclear atom 1. a sulfur-32 atom contains 16 protons, 16 neutrons, and 16 electrons. what i
    10·1 answer
  • What charge does a proton have
    8·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • 5. Using the terms: metal and nonmetal, describe what types of atoms make up each type of<br> bond.
    12·1 answer
  • Which of the following is most likely to have a crystalline structure? wood rubber glass quartz
    12·2 answers
  • How many milliliters of 2.5 M HCl are required<br> to exactly neutralize 1.5 L of 5.0 M NaOH?
    13·1 answer
  • Which best explains how photosynthesis is helpful to humans?​
    5·1 answer
  • Consider the following thermochemical reaction for kerosene:
    7·2 answers
  • Convert 5.15 meters to inches
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!