1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
3 years ago
9

A certain chemical reaction releases 31.0 kj/g of heat for each gram of reactant consumed. How can you calculate what mass of re

actant will produce of heat
Chemistry
1 answer:
Aleksandr-060686 [28]3 years ago
7 0

Answer:

See explanation.

Explanation:

Hello!

In this case, since we know the heat of reaction per gram of reactant and we should know the total energy of reaction, but it is not there, we are going to assume it is 1200 J as usual in these problems, so you can change it to whatever your given heat is.

In such a way, we set up the math as shown below:

m= 1200J*\frac{1kJ}{1000J}*\frac{1g}{31.0kJ}

Which results:

m=0.0387g

Best regards!

You might be interested in
How many moles of mercury(Hg) are in 1.30 *10.7 atoms or mercury
Svetach [21]
1 mole Hg --------------- 6.02x10²³ atoms
?? moles Hg ------------ 1.30x10⁷ atoms

(1.30x10⁷) x 1 / 6.02x10²³ => 2.159x10⁻¹⁷ moles 
5 0
3 years ago
What lines up with south poles pointing toward the magnet
Olin [163]
I think the answer is magnetic field?
4 0
3 years ago
Read 2 more answers
If 3 moles of a compound use 12 J of energy in a reaction, what is the Hreaction in kJ/mol
igomit [66]

Answer:

\Delta _RH=4x10^{-3}\frac{kJ}{mol}

Explanation:

Hello,

In this case, the molar enthalpy of reaction is obtained by dividing the involved energy by the reacting moles:

\Delta _RH=\frac{12J}{3mol} =4\frac{J}{mol}

Thus, it is important to notice that the compound "uses" the energy, it means that it absorbs the energy, for that reason the sign is positive. Moreover, computing the result in kJ/mol we finally obtain:

\Delta _RH=4\frac{J}{mol}*\frac{1kJ}{1000J} =4x10^{-3}\frac{kJ}{mol}

Best regards.

5 0
3 years ago
Helppppppppppp!!!!!!!!
Natali5045456 [20]

Pressure does not affect the voltage produced in a voltaic cell.

8 0
3 years ago
Determine if each statement is True or False. [ Select ] Central atoms with four electron groups will be sp3 hybridized. [ Selec
meriva

Answer:

Central atoms with four electron groups will be sp3 hybridized. True

Hybrid orbitals are delocalized over the entire molecule. False

The number of hybrid orbitals is equal to the number of atomic orbitals that are blended together. True

Atoms with a single pi bond and an octet are sp2 hybridized. True

Sometimes oxygen atoms will be sp3d hybridized in organic molecules. False

All resonance structures must be considered when assigning hybridization. False

Explanation:

When a central atom has four electron groups attached to it, then it must be sp3 hybridized. This is the case in ammonia, water, hydrogen sulphide, methane etc.

Hybridization is a valence bond concept while delocalization is a molecular orbital theory concept. Hybridized orbitals are localized on central atoms in a molecule while delocalized orbitals spread across the entire molecule.

According to valence bond theory, the number of atomic orbitals that combined to give hybrid orbitals must be equal to the number of hybrid orbitals formed.

When an atom has a single pi bond and on octet of electrons, then it must be sp2 hybridized. Remember that in ethene for instance, carbon has one pi bond and an octet of electrons.

Oxygen has an empty n=3 level hence it can not have d-orbitals involved in hybridization.

The electron domain geometry of the molecule is considered when assigning hybridization and not the resonance structures. All the resonance structures must have the central atom in the same hybridization state.

8 0
3 years ago
Other questions:
  • Which of the following is a compound machine?
    14·2 answers
  • What is the percentage error of length measurement of 0.229cm if the correct value is 0.225cm
    9·2 answers
  • How many moles are present in 45.0 g of lithium oxide (Li2O)?
    9·1 answer
  • What is silver tarnishishes chemical or physical change​
    11·1 answer
  • True or False;<br> aa is faster moving lava than pahoehoe?
    11·1 answer
  • When oxygen is available what happens immediately after glycolysis?
    9·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • The speed you read from your speedometer is your ____________________. *
    9·1 answer
  • Help anyone????? Please
    6·1 answer
  • MAKE A POSTER OR SLIDES OF THE FOLLOWING INFORMATION
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!