1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ruslelena [56]
3 years ago
9

susan goes on a walk for 10 minutes.she walks 22 meters from where she started.what speed did susan walk in meters per minute

Chemistry
1 answer:
eimsori [14]3 years ago
6 0

Answer:

2.2 meters

Explanation:

22 meters/ 10 minute = 2.2 mpm

You might be interested in
Why is all matter affected by gravity ​
Vlad [161]

Answer:

Explanation:

Gravity:

It is the force by which the elements of matter pulls together.

Explanation:

The gravity is depend upon the mass of matter. The more mass of object the more will be the gravitational force.

The earth is most heavier than all other matter that's why all matter pulls towards the earth.

For example;

when we walk on the earth, it pull us. Our mass is less as compared to the earth that's why we fall back on the earth instead of moving upward because our pull is negligible because of greater difference in masses. The earth mass is very high.

The gravitational force is inversely proportional to the square distance of interacting objects.

As the two objects are more distance apart from each other the less will be the gravitational force.

5 0
3 years ago
Which of the following is not a form of energy?
Dafna1 [17]
The answer is pressure
3 0
3 years ago
Read 2 more answers
Predict Which molecules are more strongly attracted to one another—C 3 H 8 O molecules that make up liquid rubbing alcohol or CH
Natasha_Volkova [10]
Ch 4 molecules that makes up methane gas
7 0
3 years ago
Which type of fermentation occurs in yeast?
otez555 [7]
Fermentation occur in yeast is alcoholic.
5 0
3 years ago
Violent shaking from an earthquake can cause soil and rock on slopes to fall and cause a _____.
Mars2501 [29]
The answer is Landslide 
5 0
4 years ago
Read 2 more answers
Other questions:
  • Two jars are placed on a counter with a McDonald's French Fry inside, one has a lid, the other does not. They are left alone to
    14·1 answer
  • Is mud a suspension, solution, or colloid?
    6·2 answers
  • How much work is done if an object moves 4.5 m in has 12 Newtons of force on it
    11·1 answer
  • which objects would have a greater gravitational force between them, Objects A and B, or Objects B and C? HELPPP
    5·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which of the following is the main disadvantage to using fossil fuels?
    10·2 answers
  • Which of the following compounds would be named with a name that ends in -ene?
    5·1 answer
  • A gas that occupies 50.0 liters has its volume increased to 68 liters when the pressure was changed to 3.0 ATM. What was the ori
    15·1 answer
  • 1.12g H2 is allowed to react with 9.60 g N2, producing 1.23 g NH3.
    13·1 answer
  • How many grams of water can be vaporized by 2.153 kJ of energy?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!