B is true because liquids are still more compact than gases, although they are loose, they aren't completely free. They also don't have a definite volume, making them assume the shape of their container. As for compression, liquids are harder to compress compared to gases.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Calcium Chloride is the salt that is effective for melting ice on roads
<span><span>Law of Conservation of Mass - "The total mass after a chemical reaction is exactly the same as the mass before"</span></span><span>
</span>
Description of a nerve signal
The nerve signal, or action potential, is a coordinated movement of sodium and potassium ions across the nerve cell membrane. Here's how it works: As we discussed, the inside of the cell is slightly negatively charged (resting membrane potential of -70 to -80 mV).
