3 years ago

Choose the correct mole ratio for the balanced equation below. Ca + 2H2O → Ca(OH)2 + H2

1 answer:

5 0

Answer: For every one mole of Ca used in this reaction, two mols of H20 are used, one mole of Ca(OH)2 is formed, and one mole of H2 is formed.

Explanation: Once the equation is balanced, you can get the ratio from the coefficients. If you are looking at the ratio of Ca to H2O, the ratio is 1:2; Ca to H2 1:1.

You might be interested in

A compound has an empirical formula of Na2CO3 and a molar mass of 318g/mol. Find its

GalinKa [24]

Answer:4

Explanation:

3 0

3 years ago

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

valentina_108 [34]

TACCGAACGGTTCCAGGCCTTTCAAAG

3 0

3 years ago

How would life be different if there were 10 hours in a day

Anna71 [15]

Answer:

If there was only 10 hours in a day, including the night time it would be complexly new environment. Say you are up for 7 hours and sleep 3, in those 7 hours you would go to work for probably 4 hours, come home and do stuff for 3 then go to bed and do it all over again.

8 0

3 years ago

Hii pls help me to balance the equation thanksss

tiny-mole [99]

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

$\boxed{\pmb{\color{gold}{\sf{2SO_{2}(g) + O_{2}(g)\dashrightarrow 2SO_{3}(g)}}}}$

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

7 0

3 years ago

Read 2 more answers

A sample of water at 100°C is converted to steam after absorbing 820 kJ of heat. How grams of H2O are contained in the sample? A

Varvara68 [4.7K]

Since water is already at 100°C all the energy is used to evaporate it.
Now we can calculate how many mols of water are evaporated with 820kJ.
$N= \frac{820}{41} =20 mol$
We calculated that we got 20 mols of water evaporated. Now, all we have to do is find how many grams is a mol of water. Molar mass of water is 20.16 g/mol.
The final answer is:
$m=20*20.16=403.2g$

7 0

3 years ago