1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Diano4ka-milaya [45]
3 years ago
8

Is this correct? This is stoichiometry.

Chemistry
1 answer:
Viefleur [7K]3 years ago
7 0
Yes it’s is bc I said so
You might be interested in
Which statements about fresh-water sources are true.? (Multiple Choice) (please help asap thanks!:)
Kay [80]

Answer:

The correct answers are:
"Only about 3 percent of Earth's water is fresh water."

"About 75% percent of the fresh water on Earth is frozen in ice sheets."

"The largest source of usable fresh water is groundwater."

Explanation:

3 percent of Earth's water is most certainly fresh water. Confirmed with a few fact checks.

The largest source of usable fresh water on Earth is groundwater. It's more difficult to access but it's there and much more usable than water say frozen in ice on the sea.

The most correct option left would be 75% of Earth's freshwater being in ice sheets even though it's about 70%.

3 0
2 years ago
What is the most accurate description of c6h12o6?
storchak [24]
A chemestretic equation equation which is formed by h20 mc square hydrogen peroxide and the equation of cf6c7bu7c





Hope it helped
8 0
3 years ago
A car averages 27.5 miles per gallon
FrozenT [24]
How much is each gallon or how far are you going is the question you should be asking
6 0
3 years ago
What quantity of energy would be necessary to boil water with a mass of
anygoal [31]

Answer:

i think 554 I think

Explanation:

maybe ..

6 0
3 years ago
18.
Leno4ka [110]

Answer:

It helps the body remove heat through sweating.

Explanation:

When the weather is hot, the body tries to keep cool by sweating. The high specific heat capacity means that the body doesn't have to lose much water to stay cool.

The high specific heat capacity of water doesn’t heat the body, but it slows down the rate of heat loss when the weather is cool.

B is wrong. The body uses glucose, not water, as an energy source.

C is wrong. The high specific heat capacity of water is not connected with the body's ability to store it.

D is wrong. The high specific heat capacity of water doesn't heat the body, but it slows the rate at which it cools.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following uses the relationship between the DNA of various groups of organisms to determine how long ago they diver
    14·1 answer
  • Which of these figures probably shows a sugar solution containing a small amount of sugar dissolved in water
    14·2 answers
  • Assuming that the container is completely full, that the temperature is 22.1 ∘C, and that the atmospheric pressure is 1.1 atm ,
    13·1 answer
  • What are some possible consequences of global warming
    10·1 answer
  • Apply Concepts Hard water contains calcium
    15·1 answer
  • What is a solution in chemistry
    11·1 answer
  • What process at the surface of the Earth is part of the formation of sedimentary rocks?
    9·1 answer
  • A family pool holds 10,000 gallons of water. How many cubic centimeters is this?
    10·1 answer
  • Are new atoms made during a chemical reaction?
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!